SINGAPORE FLU or HAND MOUTH Foot Disease (HFMD)
DEFINITION
"singapore flu" is actually the disease in the world of medicine known as hand, foot and mouth disease (hfmd) or in the language of Indonesia disease, foot and mouth (ptkm). Indeed, this disease has been there in the world. Based on the reports that exist, extraordinary events of this already in 1957 in Toronto, Canada. Since there are many events around the world. In Indonesia, the disease itself is actually not a new disease. The term "flu singapore" appears because the explosion occurred when the cases and deaths due to this disease in Singapore. because of flu-like symptoms, and when that happens in Singapore (and also happens in Indonesia), many print media that makes the term "flu singapore", although this is not a standard terminology.
Causes
PTKM this disease is an infection caused by RNA viruses in the family who enter picornaviridae (pico, Spain = small), enterovirus genus (non-polio). Genus is a rhinovirus, cardiovirus, apthovirus. In the enterovirus genus consists of a coxsackie virus, coxsackie b virus, echovirus and enterovirus. The cause of the most frequently ptkm on outpatient is coxsackie A16, and that often require treatment because the situation is more serious complications or death is up to enterovirus 71. Enterovirus can cause various diseases.
epidemiology:
this disease is highly infectious and often occur in summer. PTKM is a disease that often occur in dense groups of people who attack and children age 2 months to 5 years (sometimes up to 10 years). Adults are generally more immune against enterovirus, even if it can be also affected. Penularannya through the fekal-pral (digestion) and the respiratory channel, namely from the droplet (particle saliva), runny nose, saliva, feces, fluid vesikel (deviation form of skin containing small bubble fluid) or ekskreta. Spread through direct contact is not goods, towels, clothes, food equipment, and toys that terkontaminasi by sekresi it. vectors but does not have any carrier ( "carrier") such as fly and kecoa. It gives specific immunity, but children can be affected more by ptkm virus strain other enterovirus. Incubation period of 2 - 5 days.
SYMPTOMS
At first not a high fever 2-3 days, followed by neck pain (faringitis), no appetite, runny nose, symptoms such as "flu" in general that is not death. Vesikel that arise and then broke out, there are 3-10 ulkus in the mouth, such as sariawan (tongue, gum, in the cheek) feels pain so difficult to swallow. Along with the rash relief / rash or vesikel (reddish blister / Blister small and flat), papulovesikel not ditelapak itchy hands and feet. Sometimes the rash / rash (makulopapel) have dibokong. Generally, this disease will be improved in the 7-10 days, and does not need to be treated in the hospital.
When symptoms have a significant weight, the patient should be treated in the hospital. Symptoms are quite heavy, among others:
- Hiperpireksia, namely high fever with temperatures more than 39 c.
- Fever does not go down-down
- Takikardia (a fast pulse)
- Takipneu of breath so quickly and packed
- Lazy eating, vomiting, or diarrhea with dehydration repeated.
- Letargi, weak, sleepy and hold
- Pain in the neck, arms, and legs.
- Strain-strain, or the nerve paralysis occurred kranial
- Cold sweat
- Fotofobia (not see-ray-resistant)
- Tension in the abdomen
- Halusinasi or interference awareness
Disease complications are:
- Meningitis (meningitis brain) that aseptik - encephalitis (brain inflammation)
- Myocarditis (coxsackie virus carditis) or pericarditis - acute flaccid paralysis / polio paralyzed acute ( "polio-like illness")
One group with this disease are:
1. vesicular stomatitis with exanthem (ptkm) - Cox a 16, EV 71 (disease)
2. vesicular pharyngitis (herpangina) - EV 70
3. acute lymphonodular pharyngitis - a 10 Cox
Diagnosis
Laboratory:
samples (specimens) can be taken from the feces, rektal Wipe, Wipe and serebrospinal fluid / swab ulcus in the mouth / throat, vesikel in skin biopsy specimens, or the brain.
Specimens taken with "hank's virus transport." isolation of virus with the cell culture with the suckling mouse inoculation. After the "tissue culture", and can be identified with the antisera specific strainnya / IPA, ct, etc. PCR. examination can be done to see an increase in antibody titer.
Diagnostic laboratories are as follows:
1. virus detection:
- Immuno histochemistry (in situ)
- Imunofluoresensi antibody (indirek)
- Isolation and identification of the virus.
in vero cells; rd; l20b
netralisasi test against intersekting pools
antisera (Schmidt pools) or EV-71 (Nagoya) antiserum.
2. RNA detection:
rt-PCR
primer: 5 'ctactttgggtgtccgtgtt 3 "
5 'gggaacttcgattaccatcc 3 "
partial dna sekuensing (PCR product)
3. serodiagnosis:
serokonversi paired sera with the test serum netralisasi against EV-71 virus (brcr, Nagoya) on vero cells. Elisa test is being developed. The actual clinical enough to diagnose ptkm, we can only mengatahui whether a cause-coxsackie enterovirus 16 or 71.
Medicine
1 .. adequate rest
2. there is no specific treatment, so only the simptomatik only given based on the clinical situation.
3. can be given:
- Iv immunoglobulin (igiv), in patients imunokompromis or neonatus
- Extracorporeal Membrane oxygenation.
4. treatment simptomatik:
- Antiseptic in the mouth
- Analgesic eg paracetamol
- Fluid enough to dehydration caused by drinking and difficult because of fever
- Suportif other treatment (diet, etc.)
This disease is "self limiting diseases", namely can be cured by itself, in 7-10 days, patients need to rest because the body's resistance to decrease. Patients who are treated with the weight and symptoms of complications, respectively.
PREVENTION
disease prevention and control:
This disease often occurs in people with a lack of good sanitation. Prevention of disease is to eliminate kekumuhan and density environment; hygiene (hygiene and sanitation) environment and individuals.
Way that is most easily done for example wont always wash hands, particularly after quarters with people, food decontamination equipment, toys, towels that allows terkontaminasi.
If the child does not need to attend school for one week after the rash arising lost to heat. Patients do not actually need to be deported because ekskresi virus still take several weeks after symptoms disappear, it is important to maintain the hygiene of individuals.
In the hospital "universal precaution" should be implemented. This disease can not be prevented with a vaccine (immunization)
The government's efforts in this regard:
Increasing surveillance epidemiology (clinical definition of need) to provide counseling about ways of transmission and prevention ptkm to cut the chain of transmission. Provide counseling about the signs and symptoms ptkm
keep the individual.
When the child is not treated, it should rest at home for:
- Decreased body resistance.
- Not transmit kebalita other.
set up health facilities, including about tatalaksana ptkm
implementation of the "universal precaution" is.
Related news:
http://www.sinarharapan.co.id/berita/0109/07/fea01.html
http://www.litbang.depkes..go.id/aktual/kliping/virus_singapura190306.htm
Tuesday, May 12, 2009
Thursday, March 5, 2009
Hardware : Strategies to maximize the life of your hard drive
If you ask me the question: what part of your team is the most fragile, what would you say? What if I asked what part is most important to you?
Often the answer to both questions is your hard drive.
Your hard drive is probably one of the most important things you possess. It contains work data, school data, emails, photos, music, movies, tax information, etc ... Indeed, the hard drive is also one of only two moving components in the computer (the other is your optical drive). The following is a list of maintenance and monitoring techniques you can use to maximize the life of your hard drive and prevent data loss.
Hard disks are physically fragile - handle with care
Statistics show that 25% of data loss due to a failure of a portable unit. (Source: 2001 Cost of Downtime Survey Results)
Contrary to its rugged appearance appearance, the hard drive is a very delicate device that writes and reads data using microscopic magnetic particles. Of vibration, shock, and other negligent operation may damage the unit and cause or contribute to the possibility of failure. This is particularly important for notebook users, as they are at increased risk of drive failure due to physical damage, theft and other causes beyond its control. Therefore we recommend regular backup of laptop hard drives, as often as possible.
Possible solutions include external USB or Firewire drives (although these are prone to the same risks), desktop synchronization, or backup to a data center via the web.
Hard drives write data in a nonlinear forcing it to split.
When files accumulate on your hard drive, not just get written in a linear fashion. A hard drive writes files into small pieces and scatter over the surface. The most complete of its hard disc and becomes the more files you save and delete the worst of the fragmentation of files can be. Hard drive to increase access times to fragmentation and the unit must work harder to find all the pieces of the files. The more fragmented the data is, the harder the actuator arm has to work to find each piece of a file.
An example of this: Disk fragmentation is a common problem for users of Outlook Express and the database software. Each time you save the prospects for new mail, it does so in a different physical location of the previous time. This translates into extreme fragmentation, causing hard drive and access times, and forcing more tension in the head. This variety can lead to a crash, and often, which means an almost irretrievable drive.Finally, for a total accident, a fragmentation unit is much more difficult to recover a healthy defragged drive.
Fortunately, Windows makes it easy to defragment your drive, simply start the Disk Defragmenter utility (Start> Programs> Accessories> System Tools), choose which disk or partition you want to defragment and put to work at night or while they are not actively using your computer. Defragmenter will accelerate the team and ensure a longer life of your hard drive.
A very small power can fry a hard drive - use a UPS and shut down your computer when you can
Another little known fact about the fragility of the hard drive is its susceptibility to electrical fault. An electrical failure can be caused by an increase in power, lightning, power brown-outs, incorrect wiring, faulty or an old power supply, and many other factors. If a power comes into your computer, you can make an unpredictable amount of damage, including destruction of the hard drive electronics or heads crashing and possibly resulting in total loss of data.
The best way to protect your computer from such threats is to use a power bar or a nominal protected Uninterruptible Power Supply (UPS). Although these devices do not eliminate the chances of an accident, will serve as an effective protection in most cases. Also, you can minimize the danger of an electrical problem and reduce the wear on your hard drive by turning off the computer or using the methods of saving energy whenever possible. It is a known fact that 100% of the units, the question is when will happen and will be ready? Be sure to check the base of the section of our website for more detailed information on how electricity affects their team.
Be smart, monitor the health of your drive to avoid unexpected accidents
All hard drives have a self-monitoring technology called SMART (Self Monitoring Analysis and Reporting Technology). What most people do not realize is that most hard drive failures need not be unexpected. Most failures occur as a result of long-term problems that can be predicted. By regularly monitoring the health and performance of disk, you can know about potential hard drive problems before losing any of your data.
Several excellent services are available, including the stellar DiskView and SMART standard IDE and SATA desktop drives. Also available are instruments that monitor the health of the SCSI RAID array and complete systems. Ariolic software offers a great utility called ActiveSMART.
The only foolproof test to avoid loss of data is ... Backup!
If only one of the suggestions here to heart, it is this: Always back up your important data. After all the monitoring and prevention measures are in place, the fact remains: not all disks. Regular backups will ensure that you're never caught without their critical data. For individuals, the simplest solutions include portable external hard drives, dvd's, and online storage. For businesses, we recommend renting space in a secure data center and implementing a disaster recovery plan, regardless of the size of your business.
I hope that the above techniques give you an idea of the importance of hard drive maintenance and provide some ideas of how to protect yourself from data loss.
Often the answer to both questions is your hard drive.
Your hard drive is probably one of the most important things you possess. It contains work data, school data, emails, photos, music, movies, tax information, etc ... Indeed, the hard drive is also one of only two moving components in the computer (the other is your optical drive). The following is a list of maintenance and monitoring techniques you can use to maximize the life of your hard drive and prevent data loss.
Hard disks are physically fragile - handle with care
Statistics show that 25% of data loss due to a failure of a portable unit. (Source: 2001 Cost of Downtime Survey Results)
Contrary to its rugged appearance appearance, the hard drive is a very delicate device that writes and reads data using microscopic magnetic particles. Of vibration, shock, and other negligent operation may damage the unit and cause or contribute to the possibility of failure. This is particularly important for notebook users, as they are at increased risk of drive failure due to physical damage, theft and other causes beyond its control. Therefore we recommend regular backup of laptop hard drives, as often as possible.
Possible solutions include external USB or Firewire drives (although these are prone to the same risks), desktop synchronization, or backup to a data center via the web.
Hard drives write data in a nonlinear forcing it to split.
When files accumulate on your hard drive, not just get written in a linear fashion. A hard drive writes files into small pieces and scatter over the surface. The most complete of its hard disc and becomes the more files you save and delete the worst of the fragmentation of files can be. Hard drive to increase access times to fragmentation and the unit must work harder to find all the pieces of the files. The more fragmented the data is, the harder the actuator arm has to work to find each piece of a file.
An example of this: Disk fragmentation is a common problem for users of Outlook Express and the database software. Each time you save the prospects for new mail, it does so in a different physical location of the previous time. This translates into extreme fragmentation, causing hard drive and access times, and forcing more tension in the head. This variety can lead to a crash, and often, which means an almost irretrievable drive.Finally, for a total accident, a fragmentation unit is much more difficult to recover a healthy defragged drive.
Fortunately, Windows makes it easy to defragment your drive, simply start the Disk Defragmenter utility (Start> Programs> Accessories> System Tools), choose which disk or partition you want to defragment and put to work at night or while they are not actively using your computer. Defragmenter will accelerate the team and ensure a longer life of your hard drive.
A very small power can fry a hard drive - use a UPS and shut down your computer when you can
Another little known fact about the fragility of the hard drive is its susceptibility to electrical fault. An electrical failure can be caused by an increase in power, lightning, power brown-outs, incorrect wiring, faulty or an old power supply, and many other factors. If a power comes into your computer, you can make an unpredictable amount of damage, including destruction of the hard drive electronics or heads crashing and possibly resulting in total loss of data.
The best way to protect your computer from such threats is to use a power bar or a nominal protected Uninterruptible Power Supply (UPS). Although these devices do not eliminate the chances of an accident, will serve as an effective protection in most cases. Also, you can minimize the danger of an electrical problem and reduce the wear on your hard drive by turning off the computer or using the methods of saving energy whenever possible. It is a known fact that 100% of the units, the question is when will happen and will be ready? Be sure to check the base of the section of our website for more detailed information on how electricity affects their team.
Be smart, monitor the health of your drive to avoid unexpected accidents
All hard drives have a self-monitoring technology called SMART (Self Monitoring Analysis and Reporting Technology). What most people do not realize is that most hard drive failures need not be unexpected. Most failures occur as a result of long-term problems that can be predicted. By regularly monitoring the health and performance of disk, you can know about potential hard drive problems before losing any of your data.
Several excellent services are available, including the stellar DiskView and SMART standard IDE and SATA desktop drives. Also available are instruments that monitor the health of the SCSI RAID array and complete systems. Ariolic software offers a great utility called ActiveSMART.
The only foolproof test to avoid loss of data is ... Backup!
If only one of the suggestions here to heart, it is this: Always back up your important data. After all the monitoring and prevention measures are in place, the fact remains: not all disks. Regular backups will ensure that you're never caught without their critical data. For individuals, the simplest solutions include portable external hard drives, dvd's, and online storage. For businesses, we recommend renting space in a secure data center and implementing a disaster recovery plan, regardless of the size of your business.
I hope that the above techniques give you an idea of the importance of hard drive maintenance and provide some ideas of how to protect yourself from data loss.
Labels :
hardware
Subscribe to:
Posts (Atom)
