SINGAPORE FLU or HAND MOUTH Foot Disease (HFMD)
DEFINITION
"singapore flu" is actually the disease in the world of medicine known as hand, foot and mouth disease (hfmd) or in the language of Indonesia disease, foot and mouth (ptkm). Indeed, this disease has been there in the world. Based on the reports that exist, extraordinary events of this already in 1957 in Toronto, Canada. Since there are many events around the world. In Indonesia, the disease itself is actually not a new disease. The term "flu singapore" appears because the explosion occurred when the cases and deaths due to this disease in Singapore. because of flu-like symptoms, and when that happens in Singapore (and also happens in Indonesia), many print media that makes the term "flu singapore", although this is not a standard terminology.
Causes
PTKM this disease is an infection caused by RNA viruses in the family who enter picornaviridae (pico, Spain = small), enterovirus genus (non-polio). Genus is a rhinovirus, cardiovirus, apthovirus. In the enterovirus genus consists of a coxsackie virus, coxsackie b virus, echovirus and enterovirus. The cause of the most frequently ptkm on outpatient is coxsackie A16, and that often require treatment because the situation is more serious complications or death is up to enterovirus 71. Enterovirus can cause various diseases.
epidemiology:
this disease is highly infectious and often occur in summer. PTKM is a disease that often occur in dense groups of people who attack and children age 2 months to 5 years (sometimes up to 10 years). Adults are generally more immune against enterovirus, even if it can be also affected. Penularannya through the fekal-pral (digestion) and the respiratory channel, namely from the droplet (particle saliva), runny nose, saliva, feces, fluid vesikel (deviation form of skin containing small bubble fluid) or ekskreta. Spread through direct contact is not goods, towels, clothes, food equipment, and toys that terkontaminasi by sekresi it. vectors but does not have any carrier ( "carrier") such as fly and kecoa. It gives specific immunity, but children can be affected more by ptkm virus strain other enterovirus. Incubation period of 2 - 5 days.
SYMPTOMS
At first not a high fever 2-3 days, followed by neck pain (faringitis), no appetite, runny nose, symptoms such as "flu" in general that is not death. Vesikel that arise and then broke out, there are 3-10 ulkus in the mouth, such as sariawan (tongue, gum, in the cheek) feels pain so difficult to swallow. Along with the rash relief / rash or vesikel (reddish blister / Blister small and flat), papulovesikel not ditelapak itchy hands and feet. Sometimes the rash / rash (makulopapel) have dibokong. Generally, this disease will be improved in the 7-10 days, and does not need to be treated in the hospital.
When symptoms have a significant weight, the patient should be treated in the hospital. Symptoms are quite heavy, among others:
- Hiperpireksia, namely high fever with temperatures more than 39 c.
- Fever does not go down-down
- Takikardia (a fast pulse)
- Takipneu of breath so quickly and packed
- Lazy eating, vomiting, or diarrhea with dehydration repeated.
- Letargi, weak, sleepy and hold
- Pain in the neck, arms, and legs.
- Strain-strain, or the nerve paralysis occurred kranial
- Cold sweat
- Fotofobia (not see-ray-resistant)
- Tension in the abdomen
- Halusinasi or interference awareness
Disease complications are:
- Meningitis (meningitis brain) that aseptik - encephalitis (brain inflammation)
- Myocarditis (coxsackie virus carditis) or pericarditis - acute flaccid paralysis / polio paralyzed acute ( "polio-like illness")
One group with this disease are:
1. vesicular stomatitis with exanthem (ptkm) - Cox a 16, EV 71 (disease)
2. vesicular pharyngitis (herpangina) - EV 70
3. acute lymphonodular pharyngitis - a 10 Cox
Diagnosis
Laboratory:
samples (specimens) can be taken from the feces, rektal Wipe, Wipe and serebrospinal fluid / swab ulcus in the mouth / throat, vesikel in skin biopsy specimens, or the brain.
Specimens taken with "hank's virus transport." isolation of virus with the cell culture with the suckling mouse inoculation. After the "tissue culture", and can be identified with the antisera specific strainnya / IPA, ct, etc. PCR. examination can be done to see an increase in antibody titer.
Diagnostic laboratories are as follows:
1. virus detection:
- Immuno histochemistry (in situ)
- Imunofluoresensi antibody (indirek)
- Isolation and identification of the virus.
in vero cells; rd; l20b
netralisasi test against intersekting pools
antisera (Schmidt pools) or EV-71 (Nagoya) antiserum.
2. RNA detection:
rt-PCR
primer: 5 'ctactttgggtgtccgtgtt 3 "
5 'gggaacttcgattaccatcc 3 "
partial dna sekuensing (PCR product)
3. serodiagnosis:
serokonversi paired sera with the test serum netralisasi against EV-71 virus (brcr, Nagoya) on vero cells. Elisa test is being developed. The actual clinical enough to diagnose ptkm, we can only mengatahui whether a cause-coxsackie enterovirus 16 or 71.
Medicine
1 .. adequate rest
2. there is no specific treatment, so only the simptomatik only given based on the clinical situation.
3. can be given:
- Iv immunoglobulin (igiv), in patients imunokompromis or neonatus
- Extracorporeal Membrane oxygenation.
4. treatment simptomatik:
- Antiseptic in the mouth
- Analgesic eg paracetamol
- Fluid enough to dehydration caused by drinking and difficult because of fever
- Suportif other treatment (diet, etc.)
This disease is "self limiting diseases", namely can be cured by itself, in 7-10 days, patients need to rest because the body's resistance to decrease. Patients who are treated with the weight and symptoms of complications, respectively.
PREVENTION
disease prevention and control:
This disease often occurs in people with a lack of good sanitation. Prevention of disease is to eliminate kekumuhan and density environment; hygiene (hygiene and sanitation) environment and individuals.
Way that is most easily done for example wont always wash hands, particularly after quarters with people, food decontamination equipment, toys, towels that allows terkontaminasi.
If the child does not need to attend school for one week after the rash arising lost to heat. Patients do not actually need to be deported because ekskresi virus still take several weeks after symptoms disappear, it is important to maintain the hygiene of individuals.
In the hospital "universal precaution" should be implemented. This disease can not be prevented with a vaccine (immunization)
The government's efforts in this regard:
Increasing surveillance epidemiology (clinical definition of need) to provide counseling about ways of transmission and prevention ptkm to cut the chain of transmission. Provide counseling about the signs and symptoms ptkm
keep the individual.
When the child is not treated, it should rest at home for:
- Decreased body resistance.
- Not transmit kebalita other.
set up health facilities, including about tatalaksana ptkm
implementation of the "universal precaution" is.
Related news:
http://www.sinarharapan.co.id/berita/0109/07/fea01.html
http://www.litbang.depkes..go.id/aktual/kliping/virus_singapura190306.htm
Tuesday, May 12, 2009
Thursday, March 5, 2009
Hardware : Strategies to maximize the life of your hard drive
If you ask me the question: what part of your team is the most fragile, what would you say? What if I asked what part is most important to you?
Often the answer to both questions is your hard drive.
Your hard drive is probably one of the most important things you possess. It contains work data, school data, emails, photos, music, movies, tax information, etc ... Indeed, the hard drive is also one of only two moving components in the computer (the other is your optical drive). The following is a list of maintenance and monitoring techniques you can use to maximize the life of your hard drive and prevent data loss.
Hard disks are physically fragile - handle with care
Statistics show that 25% of data loss due to a failure of a portable unit. (Source: 2001 Cost of Downtime Survey Results)
Contrary to its rugged appearance appearance, the hard drive is a very delicate device that writes and reads data using microscopic magnetic particles. Of vibration, shock, and other negligent operation may damage the unit and cause or contribute to the possibility of failure. This is particularly important for notebook users, as they are at increased risk of drive failure due to physical damage, theft and other causes beyond its control. Therefore we recommend regular backup of laptop hard drives, as often as possible.
Possible solutions include external USB or Firewire drives (although these are prone to the same risks), desktop synchronization, or backup to a data center via the web.
Hard drives write data in a nonlinear forcing it to split.
When files accumulate on your hard drive, not just get written in a linear fashion. A hard drive writes files into small pieces and scatter over the surface. The most complete of its hard disc and becomes the more files you save and delete the worst of the fragmentation of files can be. Hard drive to increase access times to fragmentation and the unit must work harder to find all the pieces of the files. The more fragmented the data is, the harder the actuator arm has to work to find each piece of a file.
An example of this: Disk fragmentation is a common problem for users of Outlook Express and the database software. Each time you save the prospects for new mail, it does so in a different physical location of the previous time. This translates into extreme fragmentation, causing hard drive and access times, and forcing more tension in the head. This variety can lead to a crash, and often, which means an almost irretrievable drive.Finally, for a total accident, a fragmentation unit is much more difficult to recover a healthy defragged drive.
Fortunately, Windows makes it easy to defragment your drive, simply start the Disk Defragmenter utility (Start> Programs> Accessories> System Tools), choose which disk or partition you want to defragment and put to work at night or while they are not actively using your computer. Defragmenter will accelerate the team and ensure a longer life of your hard drive.
A very small power can fry a hard drive - use a UPS and shut down your computer when you can
Another little known fact about the fragility of the hard drive is its susceptibility to electrical fault. An electrical failure can be caused by an increase in power, lightning, power brown-outs, incorrect wiring, faulty or an old power supply, and many other factors. If a power comes into your computer, you can make an unpredictable amount of damage, including destruction of the hard drive electronics or heads crashing and possibly resulting in total loss of data.
The best way to protect your computer from such threats is to use a power bar or a nominal protected Uninterruptible Power Supply (UPS). Although these devices do not eliminate the chances of an accident, will serve as an effective protection in most cases. Also, you can minimize the danger of an electrical problem and reduce the wear on your hard drive by turning off the computer or using the methods of saving energy whenever possible. It is a known fact that 100% of the units, the question is when will happen and will be ready? Be sure to check the base of the section of our website for more detailed information on how electricity affects their team.
Be smart, monitor the health of your drive to avoid unexpected accidents
All hard drives have a self-monitoring technology called SMART (Self Monitoring Analysis and Reporting Technology). What most people do not realize is that most hard drive failures need not be unexpected. Most failures occur as a result of long-term problems that can be predicted. By regularly monitoring the health and performance of disk, you can know about potential hard drive problems before losing any of your data.
Several excellent services are available, including the stellar DiskView and SMART standard IDE and SATA desktop drives. Also available are instruments that monitor the health of the SCSI RAID array and complete systems. Ariolic software offers a great utility called ActiveSMART.
The only foolproof test to avoid loss of data is ... Backup!
If only one of the suggestions here to heart, it is this: Always back up your important data. After all the monitoring and prevention measures are in place, the fact remains: not all disks. Regular backups will ensure that you're never caught without their critical data. For individuals, the simplest solutions include portable external hard drives, dvd's, and online storage. For businesses, we recommend renting space in a secure data center and implementing a disaster recovery plan, regardless of the size of your business.
I hope that the above techniques give you an idea of the importance of hard drive maintenance and provide some ideas of how to protect yourself from data loss.
Often the answer to both questions is your hard drive.
Your hard drive is probably one of the most important things you possess. It contains work data, school data, emails, photos, music, movies, tax information, etc ... Indeed, the hard drive is also one of only two moving components in the computer (the other is your optical drive). The following is a list of maintenance and monitoring techniques you can use to maximize the life of your hard drive and prevent data loss.
Hard disks are physically fragile - handle with care
Statistics show that 25% of data loss due to a failure of a portable unit. (Source: 2001 Cost of Downtime Survey Results)
Contrary to its rugged appearance appearance, the hard drive is a very delicate device that writes and reads data using microscopic magnetic particles. Of vibration, shock, and other negligent operation may damage the unit and cause or contribute to the possibility of failure. This is particularly important for notebook users, as they are at increased risk of drive failure due to physical damage, theft and other causes beyond its control. Therefore we recommend regular backup of laptop hard drives, as often as possible.
Possible solutions include external USB or Firewire drives (although these are prone to the same risks), desktop synchronization, or backup to a data center via the web.
Hard drives write data in a nonlinear forcing it to split.
When files accumulate on your hard drive, not just get written in a linear fashion. A hard drive writes files into small pieces and scatter over the surface. The most complete of its hard disc and becomes the more files you save and delete the worst of the fragmentation of files can be. Hard drive to increase access times to fragmentation and the unit must work harder to find all the pieces of the files. The more fragmented the data is, the harder the actuator arm has to work to find each piece of a file.
An example of this: Disk fragmentation is a common problem for users of Outlook Express and the database software. Each time you save the prospects for new mail, it does so in a different physical location of the previous time. This translates into extreme fragmentation, causing hard drive and access times, and forcing more tension in the head. This variety can lead to a crash, and often, which means an almost irretrievable drive.Finally, for a total accident, a fragmentation unit is much more difficult to recover a healthy defragged drive.
Fortunately, Windows makes it easy to defragment your drive, simply start the Disk Defragmenter utility (Start> Programs> Accessories> System Tools), choose which disk or partition you want to defragment and put to work at night or while they are not actively using your computer. Defragmenter will accelerate the team and ensure a longer life of your hard drive.
A very small power can fry a hard drive - use a UPS and shut down your computer when you can
Another little known fact about the fragility of the hard drive is its susceptibility to electrical fault. An electrical failure can be caused by an increase in power, lightning, power brown-outs, incorrect wiring, faulty or an old power supply, and many other factors. If a power comes into your computer, you can make an unpredictable amount of damage, including destruction of the hard drive electronics or heads crashing and possibly resulting in total loss of data.
The best way to protect your computer from such threats is to use a power bar or a nominal protected Uninterruptible Power Supply (UPS). Although these devices do not eliminate the chances of an accident, will serve as an effective protection in most cases. Also, you can minimize the danger of an electrical problem and reduce the wear on your hard drive by turning off the computer or using the methods of saving energy whenever possible. It is a known fact that 100% of the units, the question is when will happen and will be ready? Be sure to check the base of the section of our website for more detailed information on how electricity affects their team.
Be smart, monitor the health of your drive to avoid unexpected accidents
All hard drives have a self-monitoring technology called SMART (Self Monitoring Analysis and Reporting Technology). What most people do not realize is that most hard drive failures need not be unexpected. Most failures occur as a result of long-term problems that can be predicted. By regularly monitoring the health and performance of disk, you can know about potential hard drive problems before losing any of your data.
Several excellent services are available, including the stellar DiskView and SMART standard IDE and SATA desktop drives. Also available are instruments that monitor the health of the SCSI RAID array and complete systems. Ariolic software offers a great utility called ActiveSMART.
The only foolproof test to avoid loss of data is ... Backup!
If only one of the suggestions here to heart, it is this: Always back up your important data. After all the monitoring and prevention measures are in place, the fact remains: not all disks. Regular backups will ensure that you're never caught without their critical data. For individuals, the simplest solutions include portable external hard drives, dvd's, and online storage. For businesses, we recommend renting space in a secure data center and implementing a disaster recovery plan, regardless of the size of your business.
I hope that the above techniques give you an idea of the importance of hard drive maintenance and provide some ideas of how to protect yourself from data loss.
Labels :
hardware
Monday, March 2, 2009
hardware PC : Cleaning and Organizing Your Computer
It's a good idea to think about your PC as an office. Store files, programs, photographs. This can be compared to an actual office files, equipment and decorations. The operating system is the boss. With this picture in mind, consider that you have visited an office that is slow and inefficient. There are probably many different reasons for the inefficiency. This is the same with a computer. There can be many elements that slow down your computer. Perhaps the most commonly overlooked is disorganization and disorder.
Disk Cleanup
An office can accumulate a large amount of unnecessary files, machines, equipment and decorations. This is the same with your computer. One of the best ways to control this disorder is a utility to perform periodic cleaning. Windows cleaning utility called Disk Cleanup. " It removes a wide variety of files, depending on the options you have selected.
To perform a clean Windows XP disc, you can simply click on My Computer in the start menu. Right click on your "C drive" or "hard drive" and select Properties. Click "Disk Cleanup" and follow the instructions. When selecting files to clean or delete it, Windows will give you information to help you decide. Looking at the list of file types, simple click the name of the file type and read the description below in the description area. This lets you know if the files can be deleted. To select the file group just check the box next to the name of the group. When finished selecting press "OK" to finish.
Now, do a disk cleanup is not much time, only a couple of minutes and can save more time at the end by making your computer run faster. However, a disk cleanup be performed regularly and not just once in a while. One way to make this run periodically to make it a scheduled task. This will allow your computer to start automatically with intervals of the day and time determined by you. However, you can run by itself without a regularly scheduled task.
Add or Remove Programs
The information above can help you get rid of some unnecessary files, but you may also need to clean some and unnecessary programs. This can be done using the "Add or Remove Programs" utility in Windows. This is located on the control panel and lists all programs currently installed, along with an option to uninstall them. It'sa good idea to navigate through the Add / Remove programs utility from time to time just to make sure that all programs are useful.
If there are programs that are no longer used, just highlight the program and click uninstall. Windows to start the process to uninstall the program. In most cases, to finish uninstalling a program, you should restart your computer. This dump file and that are held temporarily.
The Add or Remove Programs utility is very useful, but not all programs are listed in advance. Programs that come preinstalled on the computer and the Windows operating system can also be removed. For example, Outlook Express is a default email program that comes with the Windows XP operating system. If you do not use this e-mail program can uninstall it. Click "Add / Remove Windows Components" in the Add / Remove Programs utility and follow the instructions.
Defragment
Many offices contain a large number of files and programs that are valuable and can not be thrown away. In fact, they may contain files that are not used yet, but have yet to be withheld for any reason. Although these files must remain in the office, they must be organized. This is why we create file folders that hold groups of files that are related. What you save on cabinets that are arranged in alphabetical order.
In a computer, saving files placed on your hard drive. However, they are placed in terms of time saved. Therefore, if you open a Word document and save the file as "file A" and to open another document and save it as B, which has a "file A" next to "file B. "This is fine, but if you open a" file "and then save it again, adding that the information is stored next to" file B. "
When the files are divided in this way is called a fragmented file. This means that the team must find the first part of the file, and then find the second part of the file to open a Word document. This may make your computer run slower. However, Windows has created a utility that is designed to rearrange the files so that they are no longer fragmented, but sit next to each other.
You can run Disk Defragmenter by selecting "all programs" on the start button. Then select "accessories" and "system tools" and you will see "Disk Defragmenter." In fact, this is also an alternative way to select the Disk Cleanup has been mentioned above. Before you start defragmenting your hard disk can be analyzed to see if Windows recommends defragmentation. Ie, whether or not you should defragment at this time.
If you need to defragment your computer, simply click the Defragment button. It may take a while for the team to finish this task depending on the speed of your computer and the number of files defragmented. It could take about 15-30 minutes or more. However, you can still use your computer while Disk Defragmenter is running.
Disk Cleanup
An office can accumulate a large amount of unnecessary files, machines, equipment and decorations. This is the same with your computer. One of the best ways to control this disorder is a utility to perform periodic cleaning. Windows cleaning utility called Disk Cleanup. " It removes a wide variety of files, depending on the options you have selected.
To perform a clean Windows XP disc, you can simply click on My Computer in the start menu. Right click on your "C drive" or "hard drive" and select Properties. Click "Disk Cleanup" and follow the instructions. When selecting files to clean or delete it, Windows will give you information to help you decide. Looking at the list of file types, simple click the name of the file type and read the description below in the description area. This lets you know if the files can be deleted. To select the file group just check the box next to the name of the group. When finished selecting press "OK" to finish.
Now, do a disk cleanup is not much time, only a couple of minutes and can save more time at the end by making your computer run faster. However, a disk cleanup be performed regularly and not just once in a while. One way to make this run periodically to make it a scheduled task. This will allow your computer to start automatically with intervals of the day and time determined by you. However, you can run by itself without a regularly scheduled task.
Add or Remove Programs
The information above can help you get rid of some unnecessary files, but you may also need to clean some and unnecessary programs. This can be done using the "Add or Remove Programs" utility in Windows. This is located on the control panel and lists all programs currently installed, along with an option to uninstall them. It'sa good idea to navigate through the Add / Remove programs utility from time to time just to make sure that all programs are useful.
If there are programs that are no longer used, just highlight the program and click uninstall. Windows to start the process to uninstall the program. In most cases, to finish uninstalling a program, you should restart your computer. This dump file and that are held temporarily.
The Add or Remove Programs utility is very useful, but not all programs are listed in advance. Programs that come preinstalled on the computer and the Windows operating system can also be removed. For example, Outlook Express is a default email program that comes with the Windows XP operating system. If you do not use this e-mail program can uninstall it. Click "Add / Remove Windows Components" in the Add / Remove Programs utility and follow the instructions.
Defragment
Many offices contain a large number of files and programs that are valuable and can not be thrown away. In fact, they may contain files that are not used yet, but have yet to be withheld for any reason. Although these files must remain in the office, they must be organized. This is why we create file folders that hold groups of files that are related. What you save on cabinets that are arranged in alphabetical order.
In a computer, saving files placed on your hard drive. However, they are placed in terms of time saved. Therefore, if you open a Word document and save the file as "file A" and to open another document and save it as B, which has a "file A" next to "file B. "This is fine, but if you open a" file "and then save it again, adding that the information is stored next to" file B. "
When the files are divided in this way is called a fragmented file. This means that the team must find the first part of the file, and then find the second part of the file to open a Word document. This may make your computer run slower. However, Windows has created a utility that is designed to rearrange the files so that they are no longer fragmented, but sit next to each other.
You can run Disk Defragmenter by selecting "all programs" on the start button. Then select "accessories" and "system tools" and you will see "Disk Defragmenter." In fact, this is also an alternative way to select the Disk Cleanup has been mentioned above. Before you start defragmenting your hard disk can be analyzed to see if Windows recommends defragmentation. Ie, whether or not you should defragment at this time.
If you need to defragment your computer, simply click the Defragment button. It may take a while for the team to finish this task depending on the speed of your computer and the number of files defragmented. It could take about 15-30 minutes or more. However, you can still use your computer while Disk Defragmenter is running.
Labels :
hardware
Saturday, February 21, 2009
UPS dual input connection
Increasing resistance of uninterruptible power supplies (UPS), often involves the installation of a UPS configuration known as parallel when the results of two or more modules (in working in parallel) is connected to the supply of charged through a common action bar. A group of UPS modules in parallel is known as an uninterruptible power supply. The two basic configurations are known as parallel redundancy-parallel and parallel capacity. Parallel redundant UPS systems to increase the resistance.
Resistance of parallel redundant uninterruptible power supplies can be further improved by the double entry of supplies to the UPS system is supplied separately from rectifier and static switch supplies. Relying on most of the facilities of food and power supplies UPS bypass static, but creates a single point of failure in design. Should an upstream circuit breaker trip due to a failure, the rectifier and bypass no longer have an AC power source. The use of dual input supplies from separate sources (including separate substation) eliminates this problem.
Typically, transformer-based UPS is a double standard of entry to the facility in the processor, but the model is a factory setting as an option and bypass the rectifier, in this case is based on a deadlock .
Transformer-based UPS
The dual input option in a transformer-based UPS may be selected in the installation by simply removing a connector to link the terminal entrance. The UPS can be powered from two sources of action because this type of bypass module and the rectifier are independent of each other. A typical transformer-based uninterruptible power supply has a rectifier with an input three-phase (delta) and derivation of supply that can have either a single or three phase input neutral more. Some of this type of UPS can also function without a neutral connection.
Transformer UPS
In a transformer and rectifier of the UPS deliveries require a bypass neutral connection, in the module. This type of UPS can be installed with a double, but with supplies from the same source, which is obviously not as strong as if the supplies were coming from separate sources. However, allowing a derivation of energy supply to the load in the event that the UPS has to be temporarily out of service for maintenance, service or repair. The resistance of the uninterruptible power supplies is that each project is the protection to maximize power and dual-input supplies are just one technique that can be used to ensure that the loads can keep despite problems system, such as fault conditions, overloading of closures or power problems of any kind.
Resistance of parallel redundant uninterruptible power supplies can be further improved by the double entry of supplies to the UPS system is supplied separately from rectifier and static switch supplies. Relying on most of the facilities of food and power supplies UPS bypass static, but creates a single point of failure in design. Should an upstream circuit breaker trip due to a failure, the rectifier and bypass no longer have an AC power source. The use of dual input supplies from separate sources (including separate substation) eliminates this problem.
Typically, transformer-based UPS is a double standard of entry to the facility in the processor, but the model is a factory setting as an option and bypass the rectifier, in this case is based on a deadlock .
Transformer-based UPS
The dual input option in a transformer-based UPS may be selected in the installation by simply removing a connector to link the terminal entrance. The UPS can be powered from two sources of action because this type of bypass module and the rectifier are independent of each other. A typical transformer-based uninterruptible power supply has a rectifier with an input three-phase (delta) and derivation of supply that can have either a single or three phase input neutral more. Some of this type of UPS can also function without a neutral connection.
Transformer UPS
In a transformer and rectifier of the UPS deliveries require a bypass neutral connection, in the module. This type of UPS can be installed with a double, but with supplies from the same source, which is obviously not as strong as if the supplies were coming from separate sources. However, allowing a derivation of energy supply to the load in the event that the UPS has to be temporarily out of service for maintenance, service or repair. The resistance of the uninterruptible power supplies is that each project is the protection to maximize power and dual-input supplies are just one technique that can be used to ensure that the loads can keep despite problems system, such as fault conditions, overloading of closures or power problems of any kind.
Labels :
IT
Wednesday, February 11, 2009
Electronica Education : HOW ARE WATTS, OHMS, AMPS, AND VOLTS RELATED?
by William Beaty
What's all this about Watts, Volts, and Amps? Good question. Some info is below, and more can be found at ELECTRICITY FAQ, also at Electricity is not energy and Electricity Misconceptions page. But none of these links give a direct answer to this question. A useful answer is going to be HUGE. Be warned! (grin)
Here's the extremely short answer...
Conductive objects are always full of movable electric charges, and electric currents are motions of these charges. Voltage causes electric currents because voltage acts like a pressure which pushes the conductors' own charges along. A conductor has a certain amount of electrical resistance or "friction," and friction against the flowing charges heats up the resistive object. The flow-rate of the moving charges is measured in Amperes. The transfer of electrical energy (as well as the rate of heat output) is measured in Watts. The electrical resistance is measured in Ohms. Amperes, Volts, Watts, and Ohms.
Not so simple? Then let's take a much deeper look. First the watts and amperes. Watts and amps are somewhat confusing because both are flow-rates, yet we rarely talk about the STUFF that is flowing. Is it possible to understand a flow rate without first understanding the substance which flows? For example, could we understand gallons-per-second, if we didn't understand gallons, and had never touched water? It's difficult (if not impossible) to understand a flow rate without understanding the flowing substance.
Electric current isn't a stuff. Electric current is the flow of a stuff. OK then, what's the name of the stuff that flows during an electric current? The flowing stuff is called "Charge."
AMPERES
What flows in wires? It has several names:
• Charges of electricity
• Electrons
• Electric charge
• Electrical substance
• The Electron sea
• Electric fluid
• "Charge-stuff"
A quantity of charge is measured in units called COULOMBS, and the word "ampere" means the same thing as "one coulomb of charge flowing per second." If we were talking about water, then Coulombs would be like gallons, and amperage would be like gallons-per-second.
Why do I say that amperes are confusing? Simple: textbooks almost always teach us about amperes and current, buu without first clearly explaining the coulombs and charge! Suppose that we had no name for "water," yet our teachers wanted us to learn all about the "flow" inside metal pipes? Suppose we had to understand "gallons-per-second," but we had to do this without knowing anything about water or about gallons.
If we'd never learned the word "gallon", and if we had no idea that water even existed, how could we hope to understand "flow?" We might decide that "flow" was an abstract concept. Or we might decide that invisible wetness was moving along through the piples. Or we might just give up on trying to understand plumbing at all. We could concentrate on the math and get the correct answers on the tests, but we wouldn't end up with any gut-level understanding. That's the problem with electricity and amperes.
You can only understand the electrical flow in wires (the amperes) if you first understand the stuff that flows in wires. What flows through wires? It's the charge, the particle-sea, the Coulombs...
CHARGE
"Charge" is the stuff inside wires, but usually nobody tells us that all metals are always full of movable charge. Always. A hunk of metal is like a tank full of water. Shake a metal block, and the "water" swirls around inside. This "water" is the movable electric charge found inside the metal. In our science classroom we call this by the name "electron sea," or even "electric fluid." This movable charge is part of all metals. In copper, the electric fluid is actually the outer electrons of all the copper atoms. In any metal, the outer electrons of all the atoms do not orbit the individual atoms. They do not behave as textbook diagrams usually show. Instead the atoms' outer electrons drift around inside the metal as a whole.
The movable charge-stuff within a metal gives the metal its silvery metallic color. We could even say that charge-stuff is like a silver liquid (at least it appears silver when it's in metals. When it is within some other materials, the movable charges don't look silvery. "Silvery-looking charges" is not a hard and fast rule.)
Note that this charge-stuff is "uncharged", it is neutral. It's uncharged charge! Is this impossible? No. On average, the charge inside a metal is neutral because each movable electron has a corresponding proton nearby, and the electric force-fields from the opposite charges cancel each other out. The overall charge is zero because equal quantities of opposite polarity are both present. For every positive there is a negative. But this doesn't mean that the charge-stuff is gone! Even though the charge inside a metal is cancelled out, we can still cause one polarity of charge to move along while the other polarity remains still. An electrical current is a flow of "uncharged" charges. Metal is made of negative electrons and positive protons; it's like a positive sponge soaked with negative liquid. We can make the "negative liquid" flow along.
ELECTRIC CURRENT
Whenever the charge-stuff within metals is forced to flow, we say that "electric currents" are created. The word "current" simply means "charge flow." We normally measure the flowing charges in terms of amperes.
The faster the charge-stuff moves, the higher the amperage. Watch out though, since amperes are not just the speed of the charges. The MORE charge-stuff that flows (through a bigger wire for example,) the higher the amperage. A fast flow of charge through a narrow wire can have the same amperes as a slow flow of charge through a bigger wire. Double the speed of charges in a wire and you double the current. But if you keep the speed constant, then increase the size of the wire, you also increase the amperes.
Here's a way to visualize it. Bend a metal rod to form a ring, then weld the ends together. Remember that all metals are full of "liquid" charge, so the metal ring acts like a water-filled loop of tubing. If you push a magnet's pole into this ring, the magnetic forces will cause the electron-stuff within the whole ring to turn like a wheel (as if the ring contained a movable drive-belt). By moving the magnet in and out of the metal donut, we pump the donut's movable charges, and the charges flow. That's essentially how electric generators work.
Electric generators are magnet-driven charge pumps. The moving magnetic fields push the wire's movable sea of charges, creating the amperes of charge flow, but this can only occur when a closed ring or "complete circuit" exists. Break the ring and you create a blockage, since the charges can't easily escape the metal to jump across the break in the ring. A complete ring is a "closed electric circuit," while a broken ring is an "open circuit."
Cut the ring and install a battery in the cut. This lets the battery pump the ring's charge-stuff in a circle. Batteries and generators are similar in that both can pump charge through themselves and back out again. With a battery installed in our metal ring, the battery draws charge into one end and forces it out the other, and this makes the entire contents of the metal ring start moving. Make another cut in the metal ring, install a light bulb in the cut, and then the "friction" of the narrow light bulb filament against the flowing charge-stuff creates high temperatures, and the wire filament inside the bulb glows white-hot. The battery drives the ring of charge into motion, the charge moves along like a drive belt, and the light bulb "rubs" against the moving charge, which makes the filament grow hot.
Important note: usually the charge-stuff flows extremely slowly through the wires, slower than centimeters per minute. Amperes are an extremely slow, circular flow. See SPEED OF ELECTRICITY for info.
WATTS
"Watts" have the same trouble as amperes. Watts are the name of an electrical flow... but what stuff does the flowing? Energy! A "watt" is just a fancy way of saying "quantity of electrical energy flowing per second." But what is a quantity of electrical energy? I'll get to that in a sec. Any sort of energy is measured in terms of Joules. A joule of electrical energy can move from place to place along the wires. When you transport one joule of energy through a channel every second, the flow-rate of energy is 1 Joule/Sec, and "one Joule per second" means "one watt."
What is power? The word "power" means "energy flow." In order to understand this stuff, it might help if you avoid using the word "power" at the start. The word "power" means "energy flow", so if you first practice thinking in terms of energy flow instead of in terms of power, and also think in terms of joules per second rather than watts, eventually you'll gain a good understanding of the ideas behind them. Then, once you know what you're talking about, you can start speaking in shorthand. To use the shorthand, don't say "energy flow", say "power." And say "watts" instead of "joules per second." But if you start out by saying "power" and "watts", you might never really learn what these things are, because you never really learned about energy flow and joules.
FLOWING ELECTRICAL ENERGY
OK, what then is electrical energy? It has another name: electromagnetism. Electrical energy is the same stuff as radio waves and light. It's composed of magnetic fields and electrostatic fields. A joule of radio waves is the same as a joule of electrical energy. But what does this have to do with understanding electric circuits? Quite a bit! I'll delve deeper into this. But first...
How is electric current different than energy flow? Let's take our copper ring again, the one with the battery and the light bulb. The battery speeds up the ring of charge and makes it flow, while the light bulb keeps it from speeding up too much. The battery also injects joules of electrical energy into the ring, and the light bulb takes them out again. Joules of energy flow continuously between the battery and the bulb. They flow at nearly the speed of light, and if we stretch our ring until it's thousands of miles long, the light bulb will still turn off immediately when the battery is removed. (Well, not really immediately. There will still be some joules left briefly moving along the wires, so the bulb will stay on for a tiny instant , until all the energy arrives at the bulb.) Remove the battery, and the light bulb goes dark ALMOST instantly.
AMPERES ARE NOT A FLOW OF ENERGY
Note that with the battery and bulb, the joules of energy flowed ONE WAY, down BOTH wires. The battery created the electrical energy, and the light bulb consumed it. This was not a circular flow. The energy went from battery to bulb, and none returned. At the same time, the charge-stuff flowed slowly in a circle within the entire ring. TWO THINGS WERE FLOWING AT THE SAME TIME THROUGH THE ONE CIRCUIT. There you have the difference between amperes and watts. The coulombs flow slowly in a circle, while the joules flow rapidly from an "energy source" to an "energy sink". Charge is like a rubber drive belt, and electrical energy is like the 'horsepower' sent between the distant parts of the belt. Amperes are slow and circular, while watts are fast and one-way. Amperes are a flow of copper charges, while watts are a nearly-instant flow of electrical energy created by a battery or generator. For a better view of this topic, see WHERE DOES ENERGY FLOW IN CIRCUITS?
But WHAT ARE JOULES? That's where the electromagnetism comes in. When joules of energy are flying between the battery and the bulb, they are made of invisible fields. The energy is partly made up of magnetic fields surrounding the wires. It is also made from the electric fields which extend between the two wires. Electrical-magnetic. Electromagnetic fields. The joules of electrical energy are the same "stuff" as radio waves. But in this case they're attached to the wires, and they flow along the columns of movable electrons inside the wires. The joules of electrical energy are a bit like sound waves which can flow along an air hose. Yet at the same time, electrical energy is very different than sound waves. The electrical ENERGY flows in the space around the wires, while the electric CHARGE flows inside the wires.
VOLTS
There is a relationship between amperes and watts. They are not totally separate. To understand this, we need to add "voltage" to the mix. You've probably heard that voltage is like electrical pressure. What's usually not taught is that voltage is a major part of static electricity, so whenever we deal with voltage, we're dealing with static electricity. If I grab electrons away from a wire, that wire will have excess protons left behind. If I place those electrons into another wire, then my two wires have oppositely-imbalanced charge. They have a voltage between them too, and a static-electric field extends across the space between them. THIS FIELD *IS* THE VOLTAGE. Electrostatic fields are measured in terms of volts per distance, and if you have an electric field, you always have a voltage. To create voltage, take charges out of one object and stick them in another. You always do this when you scuff your shoes across the carpet in the wintertime. Batteries and generators do this all the time too. It's part of their "pumping" action. Voltage is an electrostatic concept, and a battery is a "static electric" device.
Remember the battery in the copper ring from above? The battery acted as a charge pump. It pulled charge-stuff out of one side of the ring, and pushed it into the other side. Not only did this force the circle of charges to begin moving, it also caused a voltage-difference to appear between the two sides of the ring. It also caused an electrostatic field to appear in the space surrounding the ring. The charges within the copper ring began moving because they responded to the forces created by the voltage surrounding the ring. In this way the voltage is like pressure. By pushing the charges from one wire to the other, a voltage causes the two wires to become positive and negative... and the positive and negative wires produce a voltage. (In hydraulics we would use a pressure to drive water into a pipe, and because we drove water into a pipe the pressure in that pipe would rise.)
So, the battery "charged up" the two halves of the copper ring. The light bulb provided a path to discharge them again, and this created the flow of charge in the light bulb filament. The battery pushes charge through itself, and this also forces a pressure-imbalance in the ring, and forces charges to flow through the light bulb filament. But where does energy fit into this? To understand that, we also have to know about electrical friction or "resistance."
OHMS
Imagine a pressurized water tank. Connect a narrow hose to it and open the valve. You'll get a certain flow of water because the hose is a certain size and length. Now the interesting part: make the hose twice as long, and the flow of water decreases by exactly two times. Makes sense? If we imagine the hose to have "friction", then by doubling its length, we double its friction. (The friction always doubles whether the water is flowing or not.) Make the hose longer and the water flows slower (fewer gallons per second,) make the hose shorter and the reduced friction lets the water flow faster (more gallons per second.) Now suppose we connect a very thin wire between the ends of a battery. The battery will supply its pumping pressure (its "voltage"), and this will cause the charge-stuff inside the thin wire and the charge-stuff within the battery to start moving. The charge flows in a complete circle. Double the length of the wire, and you double the friction. The extra friction cuts the charge flow (the amperes) in half. THE FRICTION IS THE "OHMS", IT IS THE ELECTRICAL RESISTANCE. To alter the charge-flow in a circle of wire, we can change the resistance of our piece of wire by changing its length. Connect a long thin wire to a battery and the charge flow will be slow (low amps.) Connect a shorter wire to the battery and the charge will be faster (high amps.) But we can also change the flow by changing the pressure. Add another battery in series. This gives twice the pressure-difference applied to the ends of the wire circle... which doubles the flow. We've just discovered "Ohm's Law:" Ohm's law simply says that the rate of charge flow is directly proportional to the pressure difference, and if the pressure goes up, the flow goes up in proportion. It also says that the resistance affects the charge flow. If the resistance goes up while the pressure-difference stays the same, the flow gets LESS by an "inverse" proportional amount. The harder you push, the faster it flows. The bigger the resistance, the smaller the flow (if the push is kept the same.) That's Ohm's law.
Whew. NOW we can get back to energy flow.
VOLTS, AMPS, OHMS, ENERGY FLOW
Lets go back to the copper ring with the battery and bulb. Suppose the battery grabs charge-stuff out of one side of the ring and pushes it into the other. This makes charge start flowing around the whole circle, and also sends energy instantly from the battery to the light bulb. It takes a certain voltage to force the charges to flow at a certain rate, and the light bulb offers "friction" or resistance to the flow. All these things are related, but how? (Try bicycle wheel analogy.)
Here's the simplest electrical relation: THE HARDER THE PUSH, THE FASTER THE FLOW. "Ohm's Law", can be written like this:
VOLTS/OHMS = COULOMBS/SEC The harder the push, the faster
flows the charge
Note that coulombs per second is the same as "amperes." It says that a large voltage causes coulombs of charge to flow faster through a particular wire. But we usually think of current in terms of amps, not in terms of flowing charge. Here's the more common way to write Ohm's law:
VOLTS/OHMS = AMPERES Voltage across resistance causes current
Voltage divided by resistance equals current. Make the voltage twice as large, then the charges flow faster, and you get twice as much current. Make the voltage less, and the current becomes less.
Ohm's law has another feature: THE MORE FRICTION YOU HAVE, THE SLOWER THE FLOW. If you keep the voltage the same (in other words, you keep using the same battery to power your light bulb), and if you double the resistance, then the charges flow slower, and you get half as much current. Increasing the resistance is easy: just hook more than one light bulb in a series chain. The more light bulbs, the more friction, which means that current is less and each bulb glows more dimly. In the bicycle wheel analogy mentioned above, a chain of light bulbs is like several thumbs all rubbing on the same spinning tire. The more thumbs, the slower the tire moves.
Here's a third way of looking at Ohm's law: WHEN A CONSTANT CURRENT ENCOUNTERS FRICTION, A VOLTAGE APPEARS. We can rewrite Ohm's law to show this:
AMPERES x OHMS = VOLTS A flow of charge produces a voltage if
it encounters resistance
If resistance stays the same, then the more current, the more volts you get. Or, if the current is forced to stay the same and you increase the friction, then more volts appear. Since most power supplies provide a constant voltage rather than a constant current, the above equation is used less often. Usually we already know the voltage applied to a device, and we want to find the amperage. However, a current in a thin extension cord causes loss of final voltage, and also transistor circuits involve constant currents with changing voltages, so the above ideas are still very useful.
But what about joules and watts? Whenever a certain amount of charge is pushed through an electrical resistance, some electrical energy is lost from the circuit and heat is created. A certain amount of energy flows into the "frictional" resistor every second, and a certain amount of heat energy flows back out again. If we increase the voltage, then for the same hunk of charge being pushed through, more energy flows into the resistor and gets converted to heat. If we increase the hunk of charge, same thing: more heat flows out per second. Here's how to write this:
VOLTS x COULOMBS = JOULES It takes energy to push some charge
against the voltage pressure
Charge flows slowly through the resistor and back out again. For every coulomb of charge that's pulled slowly through the resistor, a certain number of joules of electrical energy race into the resistor and get converted to heat.
The above equation isn't used very often. Instead, we usually think in terms of charge flow and energy flow, not in terms of hunks of charge or hunks of energy which move. However, thinking in terms of charge hunks or energy hunks makes the concepts sensible. Once you grasp the "hunks" concepts, once you know that energy is needed to push each hunk of charge against a voltage force, afterwards we can rewrite things in terms of amps and watts. Afterwards we can say that it takes a FLOW of energy (in watts) to push a FLOW of charge (in amps) against a voltage. Yet first it's important to understand the stuff that flows. Think in terms of coulombs of charge and joules of energy.
The charge-flow and the energy-flow are usually written as amps and watts. This conceals the fact that some quantities of "stuff" are flowing. But once we understand what's really going on inside a circuit, it's simpler to write amperes of charge-flow and watts of energy-flow:
VOLTS x COULOMBS/SEC = JOULES/SEC It takes a flow of energy to make
charge flow forward against pressure
Don't forget that "Amps" is shorthand for the charge inside wires flowing per second. And "watts" is shorthand for flowing energy. We can rewrite the equation to make it look simpler. It's not really simpler. We've just hidden the complexity of the above equation. It's shorthand. But before using the shorthand, you'd better understand the full-blown concept!
VOLTS x AMPERES = WATTS Pushing a current through a voltage
requires energy flow or "power."
We can get the Ohms into the act too. Just combine this equation with Ohm's law. Charge flow is caused by volts pushing against ohms, so let's get rid of amps in the above equation and replace it with voltage and ohms. This forms the equation below. Notice: increasing the voltage will increase the energy flow that's required, but it also increases the charge flow... which increases the energy flow too! If voltage doubles, current doubles, and wattage doesn't just double, instead the doubling doubles too (wattage goes up by four times.) Tripling the voltage makes the wattage go up by NINE times. Write it like this:
VOLTS x (VOLTS/OHMS) = WATTS Voltage applied across ohms uses up a
constant flow of electrical energy
So, if you double the voltage, energy flow increases by four, but if you cut the friction in half while keeping voltage the same, energy flow goes up by two, not four. (The amperes also change, but they're hidden.)
Here's one final equation. It's almost the same as the one above, but voltage is hidden rather than ampereage:
(AMPERESxOHMS) x AMPERES = WATTS When charge is flowing against ohms,
electrical energy is being used up
So, the watts of energy flow will go up by four if you double the current. But if you can somehow force the current to stay the same, then when you double the friction in the circuit, the energy flow will only double (and the voltage will change, but that part's hidden.)
And finally, here are a couple of things which can mess you up. Think about flowing power. Try to visualize it. I hope you fail! Remember... POWER DOESN'T FLOW! The word "power" means "flow of energy." It's OK to imagine that invisible hunks of electrical energy are flowing across a circuit. That's sensible. Electrical energy is like a stuff; it can flow along, but "energy flow" cannot flow. Power is just flowing energy, so "power" itself never flows. Beware, sincemany people (and even textbooks) will talk about "flows of power." They are wrong. They should be talking about flows of electrical energy. "Flow of power" is a wrong (and fundamentally stupid) concept.
Guess what. The same books and people who talk about "flows of power" will also talk about "flows of current." They'll try to convince you that "current" is a stuff that can flow through wires. Ignore them, they're wrong. Elecric charge is like a stuff that exists inside all wires, but current is different. When pumped by a battery or a generator, the wire's internal charge-stuff starts flowing. We call the flow by the name "an electrical current." But there is no such STUFF as "current." Current cannot flow. (Ask yourself what flows in rivers, current... or water? Can you go down to the creek and collect a bucket of "current?") If you want a big shock, read through a textbook or an electronics magazine and see how many times the phrase "current flow" appears. Like the phrase "power-flow," it's not just wrong, it's STUPID. Authors are trying to teach us about flows of charge, but instead they end up convincing us that "current" is a kind of stuff! It's so weird. And it's a bit frightening because it's so widespread. It's very rare to find a book which avoids the phrase "current flow" and explain charge-flow. Most books instead talk about this crazy flow of "current." It's no wonder that students have trouble understanding electricity. They essentially think that waterpipes are totally different than circuits because you can fill a glass with water, but who on earth can imagine filling a container with "current?"
What's all this about Watts, Volts, and Amps? Good question. Some info is below, and more can be found at ELECTRICITY FAQ, also at Electricity is not energy and Electricity Misconceptions page. But none of these links give a direct answer to this question. A useful answer is going to be HUGE. Be warned! (grin)
Here's the extremely short answer...
Conductive objects are always full of movable electric charges, and electric currents are motions of these charges. Voltage causes electric currents because voltage acts like a pressure which pushes the conductors' own charges along. A conductor has a certain amount of electrical resistance or "friction," and friction against the flowing charges heats up the resistive object. The flow-rate of the moving charges is measured in Amperes. The transfer of electrical energy (as well as the rate of heat output) is measured in Watts. The electrical resistance is measured in Ohms. Amperes, Volts, Watts, and Ohms.
Not so simple? Then let's take a much deeper look. First the watts and amperes. Watts and amps are somewhat confusing because both are flow-rates, yet we rarely talk about the STUFF that is flowing. Is it possible to understand a flow rate without first understanding the substance which flows? For example, could we understand gallons-per-second, if we didn't understand gallons, and had never touched water? It's difficult (if not impossible) to understand a flow rate without understanding the flowing substance.
Electric current isn't a stuff. Electric current is the flow of a stuff. OK then, what's the name of the stuff that flows during an electric current? The flowing stuff is called "Charge."
AMPERES
What flows in wires? It has several names:
• Charges of electricity
• Electrons
• Electric charge
• Electrical substance
• The Electron sea
• Electric fluid
• "Charge-stuff"
A quantity of charge is measured in units called COULOMBS, and the word "ampere" means the same thing as "one coulomb of charge flowing per second." If we were talking about water, then Coulombs would be like gallons, and amperage would be like gallons-per-second.
Why do I say that amperes are confusing? Simple: textbooks almost always teach us about amperes and current, buu without first clearly explaining the coulombs and charge! Suppose that we had no name for "water," yet our teachers wanted us to learn all about the "flow" inside metal pipes? Suppose we had to understand "gallons-per-second," but we had to do this without knowing anything about water or about gallons.
If we'd never learned the word "gallon", and if we had no idea that water even existed, how could we hope to understand "flow?" We might decide that "flow" was an abstract concept. Or we might decide that invisible wetness was moving along through the piples. Or we might just give up on trying to understand plumbing at all. We could concentrate on the math and get the correct answers on the tests, but we wouldn't end up with any gut-level understanding. That's the problem with electricity and amperes.
You can only understand the electrical flow in wires (the amperes) if you first understand the stuff that flows in wires. What flows through wires? It's the charge, the particle-sea, the Coulombs...
CHARGE
"Charge" is the stuff inside wires, but usually nobody tells us that all metals are always full of movable charge. Always. A hunk of metal is like a tank full of water. Shake a metal block, and the "water" swirls around inside. This "water" is the movable electric charge found inside the metal. In our science classroom we call this by the name "electron sea," or even "electric fluid." This movable charge is part of all metals. In copper, the electric fluid is actually the outer electrons of all the copper atoms. In any metal, the outer electrons of all the atoms do not orbit the individual atoms. They do not behave as textbook diagrams usually show. Instead the atoms' outer electrons drift around inside the metal as a whole.
The movable charge-stuff within a metal gives the metal its silvery metallic color. We could even say that charge-stuff is like a silver liquid (at least it appears silver when it's in metals. When it is within some other materials, the movable charges don't look silvery. "Silvery-looking charges" is not a hard and fast rule.)
Note that this charge-stuff is "uncharged", it is neutral. It's uncharged charge! Is this impossible? No. On average, the charge inside a metal is neutral because each movable electron has a corresponding proton nearby, and the electric force-fields from the opposite charges cancel each other out. The overall charge is zero because equal quantities of opposite polarity are both present. For every positive there is a negative. But this doesn't mean that the charge-stuff is gone! Even though the charge inside a metal is cancelled out, we can still cause one polarity of charge to move along while the other polarity remains still. An electrical current is a flow of "uncharged" charges. Metal is made of negative electrons and positive protons; it's like a positive sponge soaked with negative liquid. We can make the "negative liquid" flow along.
ELECTRIC CURRENT
Whenever the charge-stuff within metals is forced to flow, we say that "electric currents" are created. The word "current" simply means "charge flow." We normally measure the flowing charges in terms of amperes.
The faster the charge-stuff moves, the higher the amperage. Watch out though, since amperes are not just the speed of the charges. The MORE charge-stuff that flows (through a bigger wire for example,) the higher the amperage. A fast flow of charge through a narrow wire can have the same amperes as a slow flow of charge through a bigger wire. Double the speed of charges in a wire and you double the current. But if you keep the speed constant, then increase the size of the wire, you also increase the amperes.
Here's a way to visualize it. Bend a metal rod to form a ring, then weld the ends together. Remember that all metals are full of "liquid" charge, so the metal ring acts like a water-filled loop of tubing. If you push a magnet's pole into this ring, the magnetic forces will cause the electron-stuff within the whole ring to turn like a wheel (as if the ring contained a movable drive-belt). By moving the magnet in and out of the metal donut, we pump the donut's movable charges, and the charges flow. That's essentially how electric generators work.
Electric generators are magnet-driven charge pumps. The moving magnetic fields push the wire's movable sea of charges, creating the amperes of charge flow, but this can only occur when a closed ring or "complete circuit" exists. Break the ring and you create a blockage, since the charges can't easily escape the metal to jump across the break in the ring. A complete ring is a "closed electric circuit," while a broken ring is an "open circuit."
Cut the ring and install a battery in the cut. This lets the battery pump the ring's charge-stuff in a circle. Batteries and generators are similar in that both can pump charge through themselves and back out again. With a battery installed in our metal ring, the battery draws charge into one end and forces it out the other, and this makes the entire contents of the metal ring start moving. Make another cut in the metal ring, install a light bulb in the cut, and then the "friction" of the narrow light bulb filament against the flowing charge-stuff creates high temperatures, and the wire filament inside the bulb glows white-hot. The battery drives the ring of charge into motion, the charge moves along like a drive belt, and the light bulb "rubs" against the moving charge, which makes the filament grow hot.
Important note: usually the charge-stuff flows extremely slowly through the wires, slower than centimeters per minute. Amperes are an extremely slow, circular flow. See SPEED OF ELECTRICITY for info.
WATTS
"Watts" have the same trouble as amperes. Watts are the name of an electrical flow... but what stuff does the flowing? Energy! A "watt" is just a fancy way of saying "quantity of electrical energy flowing per second." But what is a quantity of electrical energy? I'll get to that in a sec. Any sort of energy is measured in terms of Joules. A joule of electrical energy can move from place to place along the wires. When you transport one joule of energy through a channel every second, the flow-rate of energy is 1 Joule/Sec, and "one Joule per second" means "one watt."
What is power? The word "power" means "energy flow." In order to understand this stuff, it might help if you avoid using the word "power" at the start. The word "power" means "energy flow", so if you first practice thinking in terms of energy flow instead of in terms of power, and also think in terms of joules per second rather than watts, eventually you'll gain a good understanding of the ideas behind them. Then, once you know what you're talking about, you can start speaking in shorthand. To use the shorthand, don't say "energy flow", say "power." And say "watts" instead of "joules per second." But if you start out by saying "power" and "watts", you might never really learn what these things are, because you never really learned about energy flow and joules.
FLOWING ELECTRICAL ENERGY
OK, what then is electrical energy? It has another name: electromagnetism. Electrical energy is the same stuff as radio waves and light. It's composed of magnetic fields and electrostatic fields. A joule of radio waves is the same as a joule of electrical energy. But what does this have to do with understanding electric circuits? Quite a bit! I'll delve deeper into this. But first...
How is electric current different than energy flow? Let's take our copper ring again, the one with the battery and the light bulb. The battery speeds up the ring of charge and makes it flow, while the light bulb keeps it from speeding up too much. The battery also injects joules of electrical energy into the ring, and the light bulb takes them out again. Joules of energy flow continuously between the battery and the bulb. They flow at nearly the speed of light, and if we stretch our ring until it's thousands of miles long, the light bulb will still turn off immediately when the battery is removed. (Well, not really immediately. There will still be some joules left briefly moving along the wires, so the bulb will stay on for a tiny instant , until all the energy arrives at the bulb.) Remove the battery, and the light bulb goes dark ALMOST instantly.
AMPERES ARE NOT A FLOW OF ENERGY
Note that with the battery and bulb, the joules of energy flowed ONE WAY, down BOTH wires. The battery created the electrical energy, and the light bulb consumed it. This was not a circular flow. The energy went from battery to bulb, and none returned. At the same time, the charge-stuff flowed slowly in a circle within the entire ring. TWO THINGS WERE FLOWING AT THE SAME TIME THROUGH THE ONE CIRCUIT. There you have the difference between amperes and watts. The coulombs flow slowly in a circle, while the joules flow rapidly from an "energy source" to an "energy sink". Charge is like a rubber drive belt, and electrical energy is like the 'horsepower' sent between the distant parts of the belt. Amperes are slow and circular, while watts are fast and one-way. Amperes are a flow of copper charges, while watts are a nearly-instant flow of electrical energy created by a battery or generator. For a better view of this topic, see WHERE DOES ENERGY FLOW IN CIRCUITS?
But WHAT ARE JOULES? That's where the electromagnetism comes in. When joules of energy are flying between the battery and the bulb, they are made of invisible fields. The energy is partly made up of magnetic fields surrounding the wires. It is also made from the electric fields which extend between the two wires. Electrical-magnetic. Electromagnetic fields. The joules of electrical energy are the same "stuff" as radio waves. But in this case they're attached to the wires, and they flow along the columns of movable electrons inside the wires. The joules of electrical energy are a bit like sound waves which can flow along an air hose. Yet at the same time, electrical energy is very different than sound waves. The electrical ENERGY flows in the space around the wires, while the electric CHARGE flows inside the wires.
VOLTS
There is a relationship between amperes and watts. They are not totally separate. To understand this, we need to add "voltage" to the mix. You've probably heard that voltage is like electrical pressure. What's usually not taught is that voltage is a major part of static electricity, so whenever we deal with voltage, we're dealing with static electricity. If I grab electrons away from a wire, that wire will have excess protons left behind. If I place those electrons into another wire, then my two wires have oppositely-imbalanced charge. They have a voltage between them too, and a static-electric field extends across the space between them. THIS FIELD *IS* THE VOLTAGE. Electrostatic fields are measured in terms of volts per distance, and if you have an electric field, you always have a voltage. To create voltage, take charges out of one object and stick them in another. You always do this when you scuff your shoes across the carpet in the wintertime. Batteries and generators do this all the time too. It's part of their "pumping" action. Voltage is an electrostatic concept, and a battery is a "static electric" device.
Remember the battery in the copper ring from above? The battery acted as a charge pump. It pulled charge-stuff out of one side of the ring, and pushed it into the other side. Not only did this force the circle of charges to begin moving, it also caused a voltage-difference to appear between the two sides of the ring. It also caused an electrostatic field to appear in the space surrounding the ring. The charges within the copper ring began moving because they responded to the forces created by the voltage surrounding the ring. In this way the voltage is like pressure. By pushing the charges from one wire to the other, a voltage causes the two wires to become positive and negative... and the positive and negative wires produce a voltage. (In hydraulics we would use a pressure to drive water into a pipe, and because we drove water into a pipe the pressure in that pipe would rise.)
So, the battery "charged up" the two halves of the copper ring. The light bulb provided a path to discharge them again, and this created the flow of charge in the light bulb filament. The battery pushes charge through itself, and this also forces a pressure-imbalance in the ring, and forces charges to flow through the light bulb filament. But where does energy fit into this? To understand that, we also have to know about electrical friction or "resistance."
OHMS
Imagine a pressurized water tank. Connect a narrow hose to it and open the valve. You'll get a certain flow of water because the hose is a certain size and length. Now the interesting part: make the hose twice as long, and the flow of water decreases by exactly two times. Makes sense? If we imagine the hose to have "friction", then by doubling its length, we double its friction. (The friction always doubles whether the water is flowing or not.) Make the hose longer and the water flows slower (fewer gallons per second,) make the hose shorter and the reduced friction lets the water flow faster (more gallons per second.) Now suppose we connect a very thin wire between the ends of a battery. The battery will supply its pumping pressure (its "voltage"), and this will cause the charge-stuff inside the thin wire and the charge-stuff within the battery to start moving. The charge flows in a complete circle. Double the length of the wire, and you double the friction. The extra friction cuts the charge flow (the amperes) in half. THE FRICTION IS THE "OHMS", IT IS THE ELECTRICAL RESISTANCE. To alter the charge-flow in a circle of wire, we can change the resistance of our piece of wire by changing its length. Connect a long thin wire to a battery and the charge flow will be slow (low amps.) Connect a shorter wire to the battery and the charge will be faster (high amps.) But we can also change the flow by changing the pressure. Add another battery in series. This gives twice the pressure-difference applied to the ends of the wire circle... which doubles the flow. We've just discovered "Ohm's Law:" Ohm's law simply says that the rate of charge flow is directly proportional to the pressure difference, and if the pressure goes up, the flow goes up in proportion. It also says that the resistance affects the charge flow. If the resistance goes up while the pressure-difference stays the same, the flow gets LESS by an "inverse" proportional amount. The harder you push, the faster it flows. The bigger the resistance, the smaller the flow (if the push is kept the same.) That's Ohm's law.
Whew. NOW we can get back to energy flow.
VOLTS, AMPS, OHMS, ENERGY FLOW
Lets go back to the copper ring with the battery and bulb. Suppose the battery grabs charge-stuff out of one side of the ring and pushes it into the other. This makes charge start flowing around the whole circle, and also sends energy instantly from the battery to the light bulb. It takes a certain voltage to force the charges to flow at a certain rate, and the light bulb offers "friction" or resistance to the flow. All these things are related, but how? (Try bicycle wheel analogy.)
Here's the simplest electrical relation: THE HARDER THE PUSH, THE FASTER THE FLOW. "Ohm's Law", can be written like this:
VOLTS/OHMS = COULOMBS/SEC The harder the push, the faster
flows the charge
Note that coulombs per second is the same as "amperes." It says that a large voltage causes coulombs of charge to flow faster through a particular wire. But we usually think of current in terms of amps, not in terms of flowing charge. Here's the more common way to write Ohm's law:
VOLTS/OHMS = AMPERES Voltage across resistance causes current
Voltage divided by resistance equals current. Make the voltage twice as large, then the charges flow faster, and you get twice as much current. Make the voltage less, and the current becomes less.
Ohm's law has another feature: THE MORE FRICTION YOU HAVE, THE SLOWER THE FLOW. If you keep the voltage the same (in other words, you keep using the same battery to power your light bulb), and if you double the resistance, then the charges flow slower, and you get half as much current. Increasing the resistance is easy: just hook more than one light bulb in a series chain. The more light bulbs, the more friction, which means that current is less and each bulb glows more dimly. In the bicycle wheel analogy mentioned above, a chain of light bulbs is like several thumbs all rubbing on the same spinning tire. The more thumbs, the slower the tire moves.
Here's a third way of looking at Ohm's law: WHEN A CONSTANT CURRENT ENCOUNTERS FRICTION, A VOLTAGE APPEARS. We can rewrite Ohm's law to show this:
AMPERES x OHMS = VOLTS A flow of charge produces a voltage if
it encounters resistance
If resistance stays the same, then the more current, the more volts you get. Or, if the current is forced to stay the same and you increase the friction, then more volts appear. Since most power supplies provide a constant voltage rather than a constant current, the above equation is used less often. Usually we already know the voltage applied to a device, and we want to find the amperage. However, a current in a thin extension cord causes loss of final voltage, and also transistor circuits involve constant currents with changing voltages, so the above ideas are still very useful.
But what about joules and watts? Whenever a certain amount of charge is pushed through an electrical resistance, some electrical energy is lost from the circuit and heat is created. A certain amount of energy flows into the "frictional" resistor every second, and a certain amount of heat energy flows back out again. If we increase the voltage, then for the same hunk of charge being pushed through, more energy flows into the resistor and gets converted to heat. If we increase the hunk of charge, same thing: more heat flows out per second. Here's how to write this:
VOLTS x COULOMBS = JOULES It takes energy to push some charge
against the voltage pressure
Charge flows slowly through the resistor and back out again. For every coulomb of charge that's pulled slowly through the resistor, a certain number of joules of electrical energy race into the resistor and get converted to heat.
The above equation isn't used very often. Instead, we usually think in terms of charge flow and energy flow, not in terms of hunks of charge or hunks of energy which move. However, thinking in terms of charge hunks or energy hunks makes the concepts sensible. Once you grasp the "hunks" concepts, once you know that energy is needed to push each hunk of charge against a voltage force, afterwards we can rewrite things in terms of amps and watts. Afterwards we can say that it takes a FLOW of energy (in watts) to push a FLOW of charge (in amps) against a voltage. Yet first it's important to understand the stuff that flows. Think in terms of coulombs of charge and joules of energy.
The charge-flow and the energy-flow are usually written as amps and watts. This conceals the fact that some quantities of "stuff" are flowing. But once we understand what's really going on inside a circuit, it's simpler to write amperes of charge-flow and watts of energy-flow:
VOLTS x COULOMBS/SEC = JOULES/SEC It takes a flow of energy to make
charge flow forward against pressure
Don't forget that "Amps" is shorthand for the charge inside wires flowing per second. And "watts" is shorthand for flowing energy. We can rewrite the equation to make it look simpler. It's not really simpler. We've just hidden the complexity of the above equation. It's shorthand. But before using the shorthand, you'd better understand the full-blown concept!
VOLTS x AMPERES = WATTS Pushing a current through a voltage
requires energy flow or "power."
We can get the Ohms into the act too. Just combine this equation with Ohm's law. Charge flow is caused by volts pushing against ohms, so let's get rid of amps in the above equation and replace it with voltage and ohms. This forms the equation below. Notice: increasing the voltage will increase the energy flow that's required, but it also increases the charge flow... which increases the energy flow too! If voltage doubles, current doubles, and wattage doesn't just double, instead the doubling doubles too (wattage goes up by four times.) Tripling the voltage makes the wattage go up by NINE times. Write it like this:
VOLTS x (VOLTS/OHMS) = WATTS Voltage applied across ohms uses up a
constant flow of electrical energy
So, if you double the voltage, energy flow increases by four, but if you cut the friction in half while keeping voltage the same, energy flow goes up by two, not four. (The amperes also change, but they're hidden.)
Here's one final equation. It's almost the same as the one above, but voltage is hidden rather than ampereage:
(AMPERESxOHMS) x AMPERES = WATTS When charge is flowing against ohms,
electrical energy is being used up
So, the watts of energy flow will go up by four if you double the current. But if you can somehow force the current to stay the same, then when you double the friction in the circuit, the energy flow will only double (and the voltage will change, but that part's hidden.)
And finally, here are a couple of things which can mess you up. Think about flowing power. Try to visualize it. I hope you fail! Remember... POWER DOESN'T FLOW! The word "power" means "flow of energy." It's OK to imagine that invisible hunks of electrical energy are flowing across a circuit. That's sensible. Electrical energy is like a stuff; it can flow along, but "energy flow" cannot flow. Power is just flowing energy, so "power" itself never flows. Beware, sincemany people (and even textbooks) will talk about "flows of power." They are wrong. They should be talking about flows of electrical energy. "Flow of power" is a wrong (and fundamentally stupid) concept.
Guess what. The same books and people who talk about "flows of power" will also talk about "flows of current." They'll try to convince you that "current" is a stuff that can flow through wires. Ignore them, they're wrong. Elecric charge is like a stuff that exists inside all wires, but current is different. When pumped by a battery or a generator, the wire's internal charge-stuff starts flowing. We call the flow by the name "an electrical current." But there is no such STUFF as "current." Current cannot flow. (Ask yourself what flows in rivers, current... or water? Can you go down to the creek and collect a bucket of "current?") If you want a big shock, read through a textbook or an electronics magazine and see how many times the phrase "current flow" appears. Like the phrase "power-flow," it's not just wrong, it's STUPID. Authors are trying to teach us about flows of charge, but instead they end up convincing us that "current" is a kind of stuff! It's so weird. And it's a bit frightening because it's so widespread. It's very rare to find a book which avoids the phrase "current flow" and explain charge-flow. Most books instead talk about this crazy flow of "current." It's no wonder that students have trouble understanding electricity. They essentially think that waterpipes are totally different than circuits because you can fill a glass with water, but who on earth can imagine filling a container with "current?"
Labels :
Electronica
Monday, February 9, 2009
Hackers : Are You Safe from Hackers?
We don't use E-gold very often since most of our online business and customer sales are conducted through our online merchant account. However, we occasionally have someone who will request paying by E-gold so we keep an account there for this reason. Once a month or so we withdraw the funds and decided to do so yesterday. Imagine our dismay when we logged into our E-gold account yesterday and found our balance to be a big fat ZERO! We had checked the balance just a few days ago so we knew this was not correct. After investigating the history of the account, we found that a spend had been made to another e-gold account user WITHOUT our knowledge or authorization. We had been hacked!
Since we have up to date anti-virus and firewall software on our computer, we assumed we were safe. Not so! It seems this is not enough to keep away the hackers as the software does not prevent "Spyware" from being installed on your computer.
"Spyware" is software that gets onto your computer and literally "spies" on your activities. The spying can range from relatively harmless use of cookies tracking you across multiple websites... to extremely dangerous "keystroke loggers" which record passwords, credit cards, and other personal data. That data then gets relayed to the person who put the software on your computer.
Spyware gets on your computer in one of several different ways.
First, it rides along with software you download from the 'Net and install on your system.
Second, they come as email attachments (much like viruses) and automatically install themselves on your computer when you open the email message.
Third, hackers find an open port on your computer and use the "back door" to install basically anything they want.
And fourth, the more malicious types, like keystroke loggers, can even get installed by someone with direct physical access to your computer such as an employer, suspicious spouse, business competitor, or someone who wants to know exactly what you're doing.
So how do you protect yourself against these malicious hackers? You need a program that specifically scans your system for the tens-of-thousands of existing spyware programs along with the new ones appearing daily.
Below are two programs which specifically check for and remove spyware from your system:
"Spybot Search & Destroy" - www.safer-networking.org
"Ad Aware" - www.lavasoft.de/software/adaware/
You may have spyware lurking on your computer right now so protect yourself today by downloading one of the above programs!
As a point of reference, we contacted E-gold and informed them that we had been hacked. We provided them with the account number of the person who received the funds and asked for a contact e-mail address on the person. E-gold informed us that they could not provide that information without a "court order" and that basically there was no way of getting the money back!
Take action today to protect yourself from this growing threat! The bottom line is: - Keep your anti-virus program current
- Install a firewall
- Carefully screen software before installing it
- Scan specifically for spyware weekly
- Stay current on this growing threat.
Since we have up to date anti-virus and firewall software on our computer, we assumed we were safe. Not so! It seems this is not enough to keep away the hackers as the software does not prevent "Spyware" from being installed on your computer.
"Spyware" is software that gets onto your computer and literally "spies" on your activities. The spying can range from relatively harmless use of cookies tracking you across multiple websites... to extremely dangerous "keystroke loggers" which record passwords, credit cards, and other personal data. That data then gets relayed to the person who put the software on your computer.
Spyware gets on your computer in one of several different ways.
First, it rides along with software you download from the 'Net and install on your system.
Second, they come as email attachments (much like viruses) and automatically install themselves on your computer when you open the email message.
Third, hackers find an open port on your computer and use the "back door" to install basically anything they want.
And fourth, the more malicious types, like keystroke loggers, can even get installed by someone with direct physical access to your computer such as an employer, suspicious spouse, business competitor, or someone who wants to know exactly what you're doing.
So how do you protect yourself against these malicious hackers? You need a program that specifically scans your system for the tens-of-thousands of existing spyware programs along with the new ones appearing daily.
Below are two programs which specifically check for and remove spyware from your system:
"Spybot Search & Destroy" - www.safer-networking.org
"Ad Aware" - www.lavasoft.de/software/adaware/
You may have spyware lurking on your computer right now so protect yourself today by downloading one of the above programs!
As a point of reference, we contacted E-gold and informed them that we had been hacked. We provided them with the account number of the person who received the funds and asked for a contact e-mail address on the person. E-gold informed us that they could not provide that information without a "court order" and that basically there was no way of getting the money back!
Take action today to protect yourself from this growing threat! The bottom line is: - Keep your anti-virus program current
- Install a firewall
- Carefully screen software before installing it
- Scan specifically for spyware weekly
- Stay current on this growing threat.
Labels :
IT
Friday, February 6, 2009
Computer : Pointers For Choosing Your Laptop Computer
by: David Burton
Pointers for buying a laptop.
If you're thinking of buying a laptop computer there are undoubtedly some great deals to be found, but what should you be looking for when you're in the market for a updated or even your first laptop computer.
Well, it's always worth sitting down with a pen and paper and thinking about exactly what you need your new laptop computer to do. If you're simply going to use it for word processing and the odd email here and there you don't need the super fast processor and hard drive that can hold thousands of files, so don't let a slick salesman tell you otherwise that’s just going to hurt your pocket.
If it's a family laptop computer you're in the market for you'll want a good all rounder. kidshave a great knack of loading games and other large applications onto a PC without you knowing. which can really effect performance for when you need it for more important things like business or your own games. So make sure you get a good-sized hard drive and a good amount of ram.
Regardless of the type of laptop computer you're in the market for make sure you explain to the salesman exactly what you need it for ( ie is it for the home or on the road). More often than not they'll be able to show you in the right direction, but make sure you only spend an amount you're happy with.
If you're an online shopper then there are some great deals to be found, so just make sure you conduct proper research before jumping in to make that purchase. You'll probably see a lot of adverts for the newest laptop computer on the market , Buying a laptop computer , its just like anything else , make sure you do a good amount of research, be clear about the amount you want to spend and weigh up your options.
Laptop computer http://www.discount-notebooks.net
Pointers for buying a laptop.
If you're thinking of buying a laptop computer there are undoubtedly some great deals to be found, but what should you be looking for when you're in the market for a updated or even your first laptop computer.
Well, it's always worth sitting down with a pen and paper and thinking about exactly what you need your new laptop computer to do. If you're simply going to use it for word processing and the odd email here and there you don't need the super fast processor and hard drive that can hold thousands of files, so don't let a slick salesman tell you otherwise that’s just going to hurt your pocket.
If it's a family laptop computer you're in the market for you'll want a good all rounder. kidshave a great knack of loading games and other large applications onto a PC without you knowing. which can really effect performance for when you need it for more important things like business or your own games. So make sure you get a good-sized hard drive and a good amount of ram.
Regardless of the type of laptop computer you're in the market for make sure you explain to the salesman exactly what you need it for ( ie is it for the home or on the road). More often than not they'll be able to show you in the right direction, but make sure you only spend an amount you're happy with.
If you're an online shopper then there are some great deals to be found, so just make sure you conduct proper research before jumping in to make that purchase. You'll probably see a lot of adverts for the newest laptop computer on the market , Buying a laptop computer , its just like anything else , make sure you do a good amount of research, be clear about the amount you want to spend and weigh up your options.
Laptop computer http://www.discount-notebooks.net
Labels :
IT
Wednesday, February 4, 2009
Spam : Stop Blog Spammers
by: Len Hutton
Blogs are now an extremely popular and important part of the internet. Millions of people blog every day. As blogs have evolved over the years, so has the commenting system. Now anyone can make comments on a particular blog posting. As blog commenting has grown more popular, so has spam commenting. In this newsletter, we’ll go over why comments are a great form of feedback for your blog, how they help the credibility of your content, what spam comments are and how to prevent them from happening.
Comments – A great form of feedback
When blogs first came around, they were simply online journals. No one could post comments on a blog posting. That all changed in 1998 with OpenDiary, a site which allowed people to comment on blog postings. Now every blog, whether it is remotely or self-hosted, includes this option to comment.
Commenting is great because it allows real people to tell you what they think about your form. It gives you feedback on what you are doing right and what you may need to improve. Comments can be encouraging to you and motivate you to post more quality blog messages. Or they can be constructive criticism to make you work harder to get better at writing content.
Whatever the style of comment is, it is still very useful to your blog. High numbers of comments have the ability to make a blog look credible because they show that the blog is being read by a lot of people. That’s something that every blog owner wants, and comments help to let them know just how many people enjoy their content.
Bad comments
Unfortunately, spammers have now started to use comments as a way to spam. How do you know what a spam comment is? Well, a spam comment is a comment that only advertises another site or product. If the comment seems bland/generic with a cheap link thrown in, then it’s definitely a spam comment.
Here is an example of a typical spam comment:
“Hey, this site is really cool. Check out my really cool site at spamsite.com.”
Of course not all spam comments will be this blatant, but you get the point.
Fortunately for bloggers, as spam comments have grown, so has the ways to prevent it. Here are a couple ways that you can prevent spam comments from even being posted on your blog.
#1: Close off commenting on older blog posts
There are options for you to stop comments from being posted on any particular blog post. Lots of times, spammers will post comments in weeks or months old posts. So take away this opportunity from them to keep it from happening. Most blog hosters now offer this as a standard option in the tool panel. If one of your posts has been up for a couple weeks, close it up.
#2: Take advantage of software offered to prevent comment spam
If you host your own blog using WordPress, you can use an option in that software to prevent spam. Even if you aren’t using WordPress, you can still use other Spam comment blocking software like Spam Karma, Akismet, and Bad Behavior. While these aren’t 100% effective, they have proven to be quite effective in preventing spam from happening.
#3: Take a look at your settings and see what can be tweaked to toughen your protection
Lots of blogs now have settings to help prevent spam. If you already have a spam blocker on in your blog and are still experiencing spam, take a closer look at the settings to see if there’s anything that can be tweaked to make your protection stronger. However, if you do this, you should closely monitor your posts to make sure legit comments aren’t being blocked out. If they are, you might have to lighten up a bit.
#4: Regularly read your blog comments
Be sure to keep an eye on your comments. Even the best software or setting can’t prevent everything, so you will have to occasionally manually remove comments on your own.
By applying the above principles, you can ensure that your blog is full of only good, quality comments, which will help your credibility tremendously.
Comments are a great form of communication between yourself and your readers. They help the credibility of your blog!
About The Author
Len Hutton is a information publisher specialising in helping people start their own home based business. Get a no cost video showing you step by step how to set up a niche ebook empire at www.nicheresidualincomes.com If you are considering using Google Pay-Per-Click Ads to promote your blog check out this web site http://rowner.freegoogle.hop.clickbank.net/
Blogs are now an extremely popular and important part of the internet. Millions of people blog every day. As blogs have evolved over the years, so has the commenting system. Now anyone can make comments on a particular blog posting. As blog commenting has grown more popular, so has spam commenting. In this newsletter, we’ll go over why comments are a great form of feedback for your blog, how they help the credibility of your content, what spam comments are and how to prevent them from happening.
Comments – A great form of feedback
When blogs first came around, they were simply online journals. No one could post comments on a blog posting. That all changed in 1998 with OpenDiary, a site which allowed people to comment on blog postings. Now every blog, whether it is remotely or self-hosted, includes this option to comment.
Commenting is great because it allows real people to tell you what they think about your form. It gives you feedback on what you are doing right and what you may need to improve. Comments can be encouraging to you and motivate you to post more quality blog messages. Or they can be constructive criticism to make you work harder to get better at writing content.
Whatever the style of comment is, it is still very useful to your blog. High numbers of comments have the ability to make a blog look credible because they show that the blog is being read by a lot of people. That’s something that every blog owner wants, and comments help to let them know just how many people enjoy their content.
Bad comments
Unfortunately, spammers have now started to use comments as a way to spam. How do you know what a spam comment is? Well, a spam comment is a comment that only advertises another site or product. If the comment seems bland/generic with a cheap link thrown in, then it’s definitely a spam comment.
Here is an example of a typical spam comment:
“Hey, this site is really cool. Check out my really cool site at spamsite.com.”
Of course not all spam comments will be this blatant, but you get the point.
Fortunately for bloggers, as spam comments have grown, so has the ways to prevent it. Here are a couple ways that you can prevent spam comments from even being posted on your blog.
#1: Close off commenting on older blog posts
There are options for you to stop comments from being posted on any particular blog post. Lots of times, spammers will post comments in weeks or months old posts. So take away this opportunity from them to keep it from happening. Most blog hosters now offer this as a standard option in the tool panel. If one of your posts has been up for a couple weeks, close it up.
#2: Take advantage of software offered to prevent comment spam
If you host your own blog using WordPress, you can use an option in that software to prevent spam. Even if you aren’t using WordPress, you can still use other Spam comment blocking software like Spam Karma, Akismet, and Bad Behavior. While these aren’t 100% effective, they have proven to be quite effective in preventing spam from happening.
#3: Take a look at your settings and see what can be tweaked to toughen your protection
Lots of blogs now have settings to help prevent spam. If you already have a spam blocker on in your blog and are still experiencing spam, take a closer look at the settings to see if there’s anything that can be tweaked to make your protection stronger. However, if you do this, you should closely monitor your posts to make sure legit comments aren’t being blocked out. If they are, you might have to lighten up a bit.
#4: Regularly read your blog comments
Be sure to keep an eye on your comments. Even the best software or setting can’t prevent everything, so you will have to occasionally manually remove comments on your own.
By applying the above principles, you can ensure that your blog is full of only good, quality comments, which will help your credibility tremendously.
Comments are a great form of communication between yourself and your readers. They help the credibility of your blog!
About The Author
Len Hutton is a information publisher specialising in helping people start their own home based business. Get a no cost video showing you step by step how to set up a niche ebook empire at www.nicheresidualincomes.com If you are considering using Google Pay-Per-Click Ads to promote your blog check out this web site http://rowner.freegoogle.hop.clickbank.net/
Labels :
IT
Thursday, January 29, 2009
A Guide to RSS Aggregators
by: Terry Leslie
One of the most popular features of Internet portals, websites, pages and even emails is a frame that features an organized list of news headlines and periodic updates from other web sources. Really Simple Syndication, formerly “Rich Site Summary” or simply, RSS makes this possible.
Most users visit a lot of websites whose content continually change, such as news sites, community organization or professional association information pages, medical websites, product support pages, and blogs. As Internet surfing became an intrinsic part of business and leisure, it became important to get rid of the very tedious task of repeatedly returning to each website to see updated content.
RSS easily distributes information from different websites to a wider number of Internet users. RSS aggregators are programs that use RSS to source these updates, and then organize those lists of headlines, content and notices for easy reading. It allows computers to automatically retrieve and read the content that users want, then track changes and personalize lists of headlines that interests them.
The specially made computer programs called “RSS aggregators” were created to automatically find and retrieve the RSS feeds of pre-selected internet sites on behalf of the user and organize the results accordingly. (RSS feeds and aggregators are also sometimes referred to as "RSS Channels" and "RSS Readers".)
The RSS aggregator is like a web browser for RSS content. HTML presents information directly to users, and RSS automatically lets computers communicate with one another. While users use browsers to surf the web then load and view each page of interest, RSS aggregators keeps track of changes to many websites. The titles or descriptions are links themselves and can be used to load the web page the user wants.
RSS starts with an original Web site that has content made available by the administrator. The website creates an RSS document and registers this content with an RSS publisher that will allow other websites to syndicate the documents. The Web site also produces an RSS feed, or channel, which is available together with all other resources or documents on the particular Web server. The website will register the feed as an RSS document, with a listed directory of appropriate RSS publishers.
An RSS feed is composed of website content listed from newest to oldest. Each item usually consists of a simple title describing the item along with a more complete description and a link to a web page with the actual content being described. In some instances, the short description or title line is the all the updated information that a user wants to read (for example, final games scores in sports, weblogs post, or stock updates). Therefore, it is not even necessary to have a web page associated with the content or update items listed -- sometimes all the needed information that users need would be in the titles and short summaries themselves.
The RSS content is located in a single file on a webpage in a manner not very different from typical web pages. The difference is that the information is written in the XML computer code for use by an RSS aggregator and not by a web user like a normal HTML page.
There are 2 main parts that are involved in RSS syndication, namely: the source end and the client end.
The client end of RSS publishing makes up part of the system that gathers and uses the RSS feed. For example, Mozilla FireFox browser is typically at the client end of the RSS transaction. A user’s desktop RSS aggregator program also belongs to the client end.
Once the URL of an RSS feed is known, a user can give that address to an RSS aggregator program and have the aggregator monitor the RSS feed for changes. Numerous RSS aggregators are already preconfigured with a ready list of RSS feed URLs for popular news or information websites that a user can simply choose from.
There are many RSS aggregators that can be used by all Internet users. Some can be accessed through the Internet, some are already incorporated into email applications, and others run as a standalone program inside the personal computer.
RSS feeds have evolved into many uses. Some uses gaining popularity are:
•For online store or retail establishments: Notification of new product arrivals
•For organization or association newsletters: title listings and notification of new issues, including email newsletters
•Weather Updates and other alerts of changing geographic conditions
•Database management: Notification of new items added, or new registered members to a club or interest group.
The uses of feeds will continue to grow, because RSS aggregators make access to any information that individual users like more convenient and fun.
In the mean time, Good Luck on your journey to success…
OR if you would like to succeed immediately to create financial freedom working only 4 hours a week, check out http://www.Secrets2InternetFortunes.com.
AND for a Limited Time, you will also receive a FREE copy of a limited number of the amazing 60 page eBook “52 Highly Profitable Instant Online Business Ideas That You Can Steal As Your Own And Start Today On A Very Tight Budget!”, which is jam packed with so many ideas you can use to instantly create an automated income for life! That’s my GIFT to You as a way of saying thank you for reading my articles.
About The Author
Terry Leslie is a very successful and world renowned authority figure in both on and off line marketing, and rapid business creation. A much sought after global speaker in the areas of internet marketing, business development, self-improvement and human peak potential training.
For more Secrets to Internet Business success, check out http://www.secrets2internetfortunes.com
One of the most popular features of Internet portals, websites, pages and even emails is a frame that features an organized list of news headlines and periodic updates from other web sources. Really Simple Syndication, formerly “Rich Site Summary” or simply, RSS makes this possible.
Most users visit a lot of websites whose content continually change, such as news sites, community organization or professional association information pages, medical websites, product support pages, and blogs. As Internet surfing became an intrinsic part of business and leisure, it became important to get rid of the very tedious task of repeatedly returning to each website to see updated content.
RSS easily distributes information from different websites to a wider number of Internet users. RSS aggregators are programs that use RSS to source these updates, and then organize those lists of headlines, content and notices for easy reading. It allows computers to automatically retrieve and read the content that users want, then track changes and personalize lists of headlines that interests them.
The specially made computer programs called “RSS aggregators” were created to automatically find and retrieve the RSS feeds of pre-selected internet sites on behalf of the user and organize the results accordingly. (RSS feeds and aggregators are also sometimes referred to as "RSS Channels" and "RSS Readers".)
The RSS aggregator is like a web browser for RSS content. HTML presents information directly to users, and RSS automatically lets computers communicate with one another. While users use browsers to surf the web then load and view each page of interest, RSS aggregators keeps track of changes to many websites. The titles or descriptions are links themselves and can be used to load the web page the user wants.
RSS starts with an original Web site that has content made available by the administrator. The website creates an RSS document and registers this content with an RSS publisher that will allow other websites to syndicate the documents. The Web site also produces an RSS feed, or channel, which is available together with all other resources or documents on the particular Web server. The website will register the feed as an RSS document, with a listed directory of appropriate RSS publishers.
An RSS feed is composed of website content listed from newest to oldest. Each item usually consists of a simple title describing the item along with a more complete description and a link to a web page with the actual content being described. In some instances, the short description or title line is the all the updated information that a user wants to read (for example, final games scores in sports, weblogs post, or stock updates). Therefore, it is not even necessary to have a web page associated with the content or update items listed -- sometimes all the needed information that users need would be in the titles and short summaries themselves.
The RSS content is located in a single file on a webpage in a manner not very different from typical web pages. The difference is that the information is written in the XML computer code for use by an RSS aggregator and not by a web user like a normal HTML page.
There are 2 main parts that are involved in RSS syndication, namely: the source end and the client end.
The client end of RSS publishing makes up part of the system that gathers and uses the RSS feed. For example, Mozilla FireFox browser is typically at the client end of the RSS transaction. A user’s desktop RSS aggregator program also belongs to the client end.
Once the URL of an RSS feed is known, a user can give that address to an RSS aggregator program and have the aggregator monitor the RSS feed for changes. Numerous RSS aggregators are already preconfigured with a ready list of RSS feed URLs for popular news or information websites that a user can simply choose from.
There are many RSS aggregators that can be used by all Internet users. Some can be accessed through the Internet, some are already incorporated into email applications, and others run as a standalone program inside the personal computer.
RSS feeds have evolved into many uses. Some uses gaining popularity are:
•For online store or retail establishments: Notification of new product arrivals
•For organization or association newsletters: title listings and notification of new issues, including email newsletters
•Weather Updates and other alerts of changing geographic conditions
•Database management: Notification of new items added, or new registered members to a club or interest group.
The uses of feeds will continue to grow, because RSS aggregators make access to any information that individual users like more convenient and fun.
In the mean time, Good Luck on your journey to success…
OR if you would like to succeed immediately to create financial freedom working only 4 hours a week, check out http://www.Secrets2InternetFortunes.com.
AND for a Limited Time, you will also receive a FREE copy of a limited number of the amazing 60 page eBook “52 Highly Profitable Instant Online Business Ideas That You Can Steal As Your Own And Start Today On A Very Tight Budget!”, which is jam packed with so many ideas you can use to instantly create an automated income for life! That’s my GIFT to You as a way of saying thank you for reading my articles.
About The Author
Terry Leslie is a very successful and world renowned authority figure in both on and off line marketing, and rapid business creation. A much sought after global speaker in the areas of internet marketing, business development, self-improvement and human peak potential training.
For more Secrets to Internet Business success, check out http://www.secrets2internetfortunes.com
Labels :
IT
Monday, January 19, 2009
Spyware Removal and Prevention
Article by Ed Coyne
Angelo PC
It seems that "spyware" has almost surpassed "viruses" as the major threat to personal computers, these days. We'll talk about "spyware" here. You may have noticed that your computer just doesn't run as quickly as it used to or that it seems like the hard drive is ALWAYS "working". Your computer may have been infected with spyware. Not only is it annoying and frustrating, but it may also mean that your computer is sending out information about you and your surfing habits that you don't want sent!
The first thing I check on a new client's PC is whether or not they have an updated spyware removal program installed on their computer. An anti-spyware program is of almost no use if it hasn't been updated since you installed it a year-and-a-half ago. There are a ton of programs out there claiming to have the power to rid your computer of "spyware" or "bugs". Some are legitimate and work very well. Others only infect your computer further. Here's a short checklist of things you can do that should keep your computer running smoothly:
1. Check for and install your operating system's updates regularly. I prefer using Windows XP to anything else because of the Automatic Updates feature. If you have anything older than Windows XP, chances are that your computer is "old" and you need to treat yourself to a new one anyway! (always make sure to donate your old computers to a school or other worthy charity)
2. Have a well known anti-virus program installed and updated. There are a few good ones out there that are still FREE! Grisoft's AVG Free Edition works well. They also have a BETA version of their Anti-Virus plus Firewall bundle.
3. Have an updated firewall program installed. You can use the BETA above or you can use Zone Labs' ZoneAlarm Personal.
4. Have an updated version of Spybot Search & Destroy or Computer Associates' PestPatrol installed on your computer and run a full scan about once a week. They both seem to work well separately and even better together. One usually finds something that the other doesn't find.
5. BE CAREFUL OF WHAT YOU DOWNLOAD AND INSTALL! This can't be stressed enough. "Free" programs are usually the culprits. They are often bundled with other software that can include malicious code, even when they're from "reputable" companies. Peer2Peer file sharing programs are notorious for this. And I can almost bet that you have AOL's Instant Messenger installed on your computer. Did you know that AIM is bundled with WeatherBug, which is known to include spyware? You have to be very careful when you install "free" programs. They're almost never "free" (all of the programs linked to from this article are safe).
Following these steps can greatly reduce your risk of infection
Angelo PC
It seems that "spyware" has almost surpassed "viruses" as the major threat to personal computers, these days. We'll talk about "spyware" here. You may have noticed that your computer just doesn't run as quickly as it used to or that it seems like the hard drive is ALWAYS "working". Your computer may have been infected with spyware. Not only is it annoying and frustrating, but it may also mean that your computer is sending out information about you and your surfing habits that you don't want sent!
The first thing I check on a new client's PC is whether or not they have an updated spyware removal program installed on their computer. An anti-spyware program is of almost no use if it hasn't been updated since you installed it a year-and-a-half ago. There are a ton of programs out there claiming to have the power to rid your computer of "spyware" or "bugs". Some are legitimate and work very well. Others only infect your computer further. Here's a short checklist of things you can do that should keep your computer running smoothly:
1. Check for and install your operating system's updates regularly. I prefer using Windows XP to anything else because of the Automatic Updates feature. If you have anything older than Windows XP, chances are that your computer is "old" and you need to treat yourself to a new one anyway! (always make sure to donate your old computers to a school or other worthy charity)
2. Have a well known anti-virus program installed and updated. There are a few good ones out there that are still FREE! Grisoft's AVG Free Edition works well. They also have a BETA version of their Anti-Virus plus Firewall bundle.
3. Have an updated firewall program installed. You can use the BETA above or you can use Zone Labs' ZoneAlarm Personal.
4. Have an updated version of Spybot Search & Destroy or Computer Associates' PestPatrol installed on your computer and run a full scan about once a week. They both seem to work well separately and even better together. One usually finds something that the other doesn't find.
5. BE CAREFUL OF WHAT YOU DOWNLOAD AND INSTALL! This can't be stressed enough. "Free" programs are usually the culprits. They are often bundled with other software that can include malicious code, even when they're from "reputable" companies. Peer2Peer file sharing programs are notorious for this. And I can almost bet that you have AOL's Instant Messenger installed on your computer. Did you know that AIM is bundled with WeatherBug, which is known to include spyware? You have to be very careful when you install "free" programs. They're almost never "free" (all of the programs linked to from this article are safe).
Following these steps can greatly reduce your risk of infection
Labels :
IT
Thursday, January 15, 2009
Software – Instructor of Computer
By Mehar Grewal
A computer system consists of different parts, programs or components. Each and every part has its own importance or working. In simple, we can say that hardware means all physical components of a computer and software is a set of certain instruction, rules on the basis of which other components work.
Software instructs a computer what to do. There are different types of programming languages, which make computing possible. There are three different types of computer software: system software, programming software and application software.
System software consists of programs that controls, integrates and looks after the hardware components of a computer system. It mainly consists of operating systems (OS), database management systems (DBMS), communications control programs, and programming language translator.
Programming software helps a user to write computer programs and other programming software languages in a proper way. The Application software will take care of different tasks other than just running the computer system.
Random access memory (RAM) is the computer memory in which computer software is loaded. There are different types of software available in the market. For e.g. Antispyware Software protect your computer data from virus. The software consistency mulls over the faults, mistakes and breakdown that are related with the formation and operation of computer software.
Author presents a website on software. This website provides information about meaning and types of computer software, working of computer software, layers of software in a computer system. You can visit his site to get information about computer softwares
Article Source: http://EzineArticles.com/?expert=Mehar_Grewal
A computer system consists of different parts, programs or components. Each and every part has its own importance or working. In simple, we can say that hardware means all physical components of a computer and software is a set of certain instruction, rules on the basis of which other components work.
Software instructs a computer what to do. There are different types of programming languages, which make computing possible. There are three different types of computer software: system software, programming software and application software.
System software consists of programs that controls, integrates and looks after the hardware components of a computer system. It mainly consists of operating systems (OS), database management systems (DBMS), communications control programs, and programming language translator.
Programming software helps a user to write computer programs and other programming software languages in a proper way. The Application software will take care of different tasks other than just running the computer system.
Random access memory (RAM) is the computer memory in which computer software is loaded. There are different types of software available in the market. For e.g. Antispyware Software protect your computer data from virus. The software consistency mulls over the faults, mistakes and breakdown that are related with the formation and operation of computer software.
Author presents a website on software. This website provides information about meaning and types of computer software, working of computer software, layers of software in a computer system. You can visit his site to get information about computer softwares
Article Source: http://EzineArticles.com/?expert=Mehar_Grewal
Labels :
IT
Wednesday, January 14, 2009
Web Development And The Big Time Out
by: Scott Lindsay
One of the great debilitators in online business is simply the perceived (or real) lack of time. Business owners are used to moving forward. An online web presence can make them feel tied to an office chair learning skills they aren’t sure they want to know.
It’s not uncommon for those who deal in full time web design to have individuals contact them for a site design, but have absolutely no idea what they want. Furthermore when the designer questions them the response might be, “I don’t know, just make it look nice.”
Let’s not forget the core values or mission of the business. Many business owners have no idea how to answer those kinds of questions. They may stare blankly for a moment or two and there’s no more time for further deep thought so they go back to action – without answers.
In many cases it is possible to answer some of the questions needed, but it may require taking time away from a familiar setting. It may also require more time than you think you want to give.
If you can get to a place of concentrated contemplation you are likely to find yourself stripping ideas to their core to find out what your business is trying to accomplish and what your ultimate goals might be.
As with almost any project you can turn frustration around if you will just take the time to come to terms with your vision.
Sometimes we spend so much time ‘doing’ we never stop to ask the question, “Why?”
This process can be a bit like taking a bus that drives around the park. You keep looking at the flowers and the park bench and long to sit in the quiet shade of a tree and just absorb the calming atmosphere. You know they will have a positive effect on you, but for some reason you just can’t seem to find the energy to get off the bus.
It seems to me there are some sites that are misguided or rarely guided that could benefit from the process of self-evaluation. These sites may look nice, but there is a sense of disconnection that may not be easy to identify, but it’s fairly obvious to visitors.
Creative energy is at a minimum while business owners simply tackle what seem to be the most urgent details.
As more people gravitate to online business there needs to be a shift in the thinking of how one goes about doing business online. In many ways it can’t be approached in the same way a traditional business is developed, yet that is typically the way many new web commerce ventures choose to tackle the subject.
You may discover your business will be more successful if you take some time for rigorous reflection. The time set aside can be a bit like an architect that takes the time to develop plans for a new building. You wouldn’t expect the architect to simply tell a construction crew to, “Go out there and build – something.”
Work at ‘building’ your online business in a comprehensive way. Your effort can develop a firm foundation for long-term success.
About The Author
Scott Lindsay is a web developer and entrepreneur. Make your own website in just 5 minutes with HighPowerSites at: http://www.highpowersites.com or Build A Website at: http://www.buildagreatsite.com. Start your own ebook business with BooksWealth at: http://www.bookswealth.com
One of the great debilitators in online business is simply the perceived (or real) lack of time. Business owners are used to moving forward. An online web presence can make them feel tied to an office chair learning skills they aren’t sure they want to know.
It’s not uncommon for those who deal in full time web design to have individuals contact them for a site design, but have absolutely no idea what they want. Furthermore when the designer questions them the response might be, “I don’t know, just make it look nice.”
Let’s not forget the core values or mission of the business. Many business owners have no idea how to answer those kinds of questions. They may stare blankly for a moment or two and there’s no more time for further deep thought so they go back to action – without answers.
In many cases it is possible to answer some of the questions needed, but it may require taking time away from a familiar setting. It may also require more time than you think you want to give.
If you can get to a place of concentrated contemplation you are likely to find yourself stripping ideas to their core to find out what your business is trying to accomplish and what your ultimate goals might be.
As with almost any project you can turn frustration around if you will just take the time to come to terms with your vision.
Sometimes we spend so much time ‘doing’ we never stop to ask the question, “Why?”
This process can be a bit like taking a bus that drives around the park. You keep looking at the flowers and the park bench and long to sit in the quiet shade of a tree and just absorb the calming atmosphere. You know they will have a positive effect on you, but for some reason you just can’t seem to find the energy to get off the bus.
It seems to me there are some sites that are misguided or rarely guided that could benefit from the process of self-evaluation. These sites may look nice, but there is a sense of disconnection that may not be easy to identify, but it’s fairly obvious to visitors.
Creative energy is at a minimum while business owners simply tackle what seem to be the most urgent details.
As more people gravitate to online business there needs to be a shift in the thinking of how one goes about doing business online. In many ways it can’t be approached in the same way a traditional business is developed, yet that is typically the way many new web commerce ventures choose to tackle the subject.
You may discover your business will be more successful if you take some time for rigorous reflection. The time set aside can be a bit like an architect that takes the time to develop plans for a new building. You wouldn’t expect the architect to simply tell a construction crew to, “Go out there and build – something.”
Work at ‘building’ your online business in a comprehensive way. Your effort can develop a firm foundation for long-term success.
About The Author
Scott Lindsay is a web developer and entrepreneur. Make your own website in just 5 minutes with HighPowerSites at: http://www.highpowersites.com or Build A Website at: http://www.buildagreatsite.com. Start your own ebook business with BooksWealth at: http://www.bookswealth.com
Labels :
IT
Tuesday, January 13, 2009
The Battle of the Browsers – The History and the Future of Internet Browsers
by: Nicholas C Smith
With Internet Explorer 8 now available, can Microsoft hope to retain market dominance over fierce open source rivals such as Mozilla's Firefox or the feature packed Opera web browser. Can history give us a clue to what the future of web browsers/browsing might hold? How did Netscape Navigator go from having a dominant 89.36% market share of all web browsers in 1996 and yet only 3.76% by mid 1999?
Let us take a journey that will begin long before even the intellectual conception of Internet Explorer, that will glance at its long defeated rivals, examine the current browsers available and will end with a prediction of what the future of browsing will offer us – and which browser(s) will still be around to offer it.
People often think that Internet Explorer has been the dominant web browser since the golden age of the internet began. Well for a very long time now it has indeed been the most popular browser and at times been almost totally unrivalled. This was mainly a result of it being packaged free with Microsoft Windows, in what some would later call a brutal monopolisation attempt by Microsoft. The last few years however have heralded the arrival of new, possibly superior browsers. Mozilla's Firefox has been particularly successful at chipping away at Explorers market dominance. So where did it all begin, and why were Microsoft ever allowed to have a hundred percent market dominance?
Origins
The truth is they never did have total dominance, but at times they have come very close. Microsoft actually entered the Browser Battle quite late on. Infact a man named Neil Larson is credited to be one of the originators of internet browsers, when in 1977 he created a program – The TRS-80 - that allowed browsing between “sites” via hypertext jumps. This was a DOS program and the basis of much to come. Slowly other browsers powered by DOS and inspired by the TRS 80 were developed. Unfortunately they were often constricted by the limitations of the still fairly young internet itself.
In 1988, Peter Scott and Earle Fogel created a simple, fast browser called Hytelnet, which by 1990 offered users instant logon and access to the online catalogues of over five thousand libraries around the world – an exhilarating taste of what the internet, and web browsers, would soon be able to offer.
In 1989 the original World Wide Web was born. Using a NeXTcube computer, Tim Berners-Lee created a web browser that would change how people used the internet forever. He called his browser the WorldWideWeb(http://www., which is still likely to sound familiar to internet users today. It was a windowed browser capable of displaying simple style sheet, capable of editing sites and able to download and open any file type supported by the NeXTcube.
In 1993 the first popular graphical browser was released. Its name was Mosaic and it was created by Marc Andreessen and Eric Bina. Mosaic could be run on both Unix, and very importantly, on the highly popular Microsoft Windows operating system (incidentally it could also be used on Amiga and Apple computers). It was the first browser on Windows that could display graphics/pictures on a page where there was also textual content. It is often cited as being responsible for triggering the internet boom due to it making the internet bearable for the masses. (It should be noted that the web browser Cello was the first browser to be used on Windows – but it was non graphical and made very little impact compared to Mosaic).
The Browser Wars - Netscape Navigator versus Internet Explorer
Mosaic's decline began almost as soon as Netscape Navigator was released (1994). Netscape Navigator was a browser created by Marc Andreessen, one of the men behind Mosaic and co-founder of Netscape Communications Corporation. Netscape was unrivalled in terms of features and usability at the time. For example, one major change from previous browsers was that it allowed surfers to see parts of a website before the whole site was downloaded. This meant that people did not have to wait for minutes simply to see if the site they were loading was the actual one the were after, whilst also allowing them to read information on the site as the rest of it downloaded. By 1996 Netscape had almost 90% market dominance, as shown below.
Market Share Comparisons of Netscape Navigator and Internet Explorer from 1996 to 1998
....................Netscape.......IE
October 1998..........64%.........32.2%
April 1998............70%.........22.7%
October 1997..........59.67%......15.13%
April 1997............81.13%......12.13%
October 1996..........80.45%......12.18%
April 1996............89.36%.......3.76%
In these two years Netscape clearly dominated the internet browser market, but a new browser named Internet Explorer was quickly gaining ground on it.
Microsoft released their own browser (ironically based on the earlier Mosaic browser which was created by one of the men now running Netscape), clearly worried about Netscape's dominance. It was not so much the worry that it would have a 100% market share of internet browsers on their Windows operating system, but more the worry that browsers would soon be capable of running all types programs on them. That would mean foregoing the need for an actual operating system, or at the most only a very basic one would be needed. This in turn would mean Netscape would soon be able to dictate terms to Microsoft, and Microsoft were not going to let that happen easily. Thus in August 1995, Internet Explorer was released.
By 1999 Internet explorer had captured an 89.03% market share, whilst Netscape was down to 10.47%. How could Internet Explorer make this much ground in just two years? Well this was down to two things really. The first, and by far the most important was that Microsoft bundled Internet Explorer in with every new copy of Windows, and as Windows was used by about 90% of the computer using population it clearly gave them a huge advantage. Internet Explorer had one other ace it held over Netscape – it was much better. Netscape Navigator was stagnant and had been for some time. The only new features it ever seemed to introduce were often perceived by the public as beneficial for Netscape's parent company rather than Netscape's user base. (i.e., features that would help it monopolise the market). Explorer, on the other hand, was given much attention by Microsoft. Regular updates and excellent usability plus a hundred million dollar investment would prove too much for Netscape Explorer.
2000 – 2005
These years were fairly quiet in the Battle of the Browsers. It seemed as if Internet Explorer had won the war and that nobody could even hope to compete with it. In 2002/2003 it had attained about 95% of the market share – about the time of IE 5/6. With over 1000 people working on it and millions of dollars being poured in, few people had the resources to compete. Then again, who wanted to compete? It was clearly a volatile market, and besides that everybody was content with Internet Explorer. Or were they? Some people saw faults with IE – security issues, incompatibility issues or simply bad programming. Not only that, it was being shoved down peoples throats. There was almost no competition to keep it in line or to turn to as an alternative. Something had to change. The only people with the ability and the power to compete with Microsoft took matters into their own hands.
Netscape was now supported by AOL. A few years prior, just after they had lost the Browser Wars to Microsoft, they had released the coding for Netscape into the public domain. This meant anybody could develop their own browser using the Netscape skeleton. And people did. Epiphany, Galeon and Camino, amongst others, were born out of Netscape's ashes. However the two most popular newcomers were called Mozilla and Firefox.
Mozilla was originally an open sourced project aimed to improve the Netscape browser. Eventually it was released as Netscape Navigator 7 and then 8. Later it was released as Mozilla 1.0.
Mozilla was almost an early version on another open source browser, Firefox. With it being an open source the public were able to contribute to it - adding in what features it needed, the programming it required and the support it deserved. The problems people saw in Internet Explorer were being fixed by members of the open sourced browser community via Firefox. For instance, the many security issues IE 6 had were almost entirely fixed in the very first release of Firefox. Microsoft had another fight on their hands.
2005 – Present
Firefox was the browser that grew and grew in these years. Every year capturing an even larger market share percentage than before. More user friendly than most of its rivals along with high security levels and arguably more intelligent programming helped its popularity. With such a large programming community behind it, updates have always been regular and add on programs/features are often released. It prides itself on being the peoples browser. It currently has a 28.38% market share.
Apple computers have had their own browser since the mid 1990's – Safari - complete with its own problems, such as (until recently) the inability to run Java scripts. However most Apple users seemed happy with it and a version capable of running on Windows has been released. It has had no major competitor on Apple Macs, and as such has largely been out of the Browser Wars. It currently holds a 2.54% market share and is slowly increasing.
Internet Explorer's market share has dropped from over 90% to around 75%, and is falling. It will be interesting to see what Microsoft will attempt to regain such a high market share.
Opera currently holds 1.07%.
Mozilla itself only has a 0.6% market share these days.
The Future of Web Browsing
Web browsers come and go. It is the nature of technology (if such a term can be used), to supplant inferior software in very short periods of time. It is almost impossible for a single company to stay ahead of the competition for long. Microsoft have the advantage of being able to release IE with any Windows using PC. That covers over 90% of the market. They also have the advantage of unprecedented resources. They can compete how they wish for as long as they wish. So there is no counting IE out of the future of web browsing.
Safari is in a similar position, being easily the most popular Mac web browser. Its long term survival is dependant upon Apple and the sale of their computers.
These are the only two browsers that are almost guaranteed another five years of life, at least. Firefox may seem like another candidate, but the public is fickle, and one bad release, or if it seriously lags behind the new Internet Explorer 8 for long, could easily see its popularity quickly descend into virtual oblivion.
However, it seems likely community driven browsers, such as Mozilla and Firefox, will be the only types of browser capable of competing with the wealthy internet arm of Microsoft in the near future.
As for web browsing itself, will it change any time soon? Well it already has for some online communities. For example, if you want to buy clothes you could try entering an online 'world' creating an online virtual You to go from 'shop to shop' with, looking at products and trying/buying what you see. Some 'worlds' allow you to recreate yourself accurately including weight and height and then try on things apparel such as jeans to give you an idea of how you would look in that particular item.
Will 'worlds' like this destroy normal web browsers such as IE ? - It seems unlikely. Traditional web browsers provide such freedom and ease of access that it is hard to see any other alternative taking over. However they are part of the new, 'thinking out of the box' wave of alternatives that some people will find attractive, and really who knows what the future will bring.
About The Author
Nicholas C Smith is the project manager at Breakfrom Limited, who specialise in affordable ecommerce solutions and general web design knowledge and advice.
For more information and advice visit http://www.breakfrom.com
With Internet Explorer 8 now available, can Microsoft hope to retain market dominance over fierce open source rivals such as Mozilla's Firefox or the feature packed Opera web browser. Can history give us a clue to what the future of web browsers/browsing might hold? How did Netscape Navigator go from having a dominant 89.36% market share of all web browsers in 1996 and yet only 3.76% by mid 1999?
Let us take a journey that will begin long before even the intellectual conception of Internet Explorer, that will glance at its long defeated rivals, examine the current browsers available and will end with a prediction of what the future of browsing will offer us – and which browser(s) will still be around to offer it.
People often think that Internet Explorer has been the dominant web browser since the golden age of the internet began. Well for a very long time now it has indeed been the most popular browser and at times been almost totally unrivalled. This was mainly a result of it being packaged free with Microsoft Windows, in what some would later call a brutal monopolisation attempt by Microsoft. The last few years however have heralded the arrival of new, possibly superior browsers. Mozilla's Firefox has been particularly successful at chipping away at Explorers market dominance. So where did it all begin, and why were Microsoft ever allowed to have a hundred percent market dominance?
Origins
The truth is they never did have total dominance, but at times they have come very close. Microsoft actually entered the Browser Battle quite late on. Infact a man named Neil Larson is credited to be one of the originators of internet browsers, when in 1977 he created a program – The TRS-80 - that allowed browsing between “sites” via hypertext jumps. This was a DOS program and the basis of much to come. Slowly other browsers powered by DOS and inspired by the TRS 80 were developed. Unfortunately they were often constricted by the limitations of the still fairly young internet itself.
In 1988, Peter Scott and Earle Fogel created a simple, fast browser called Hytelnet, which by 1990 offered users instant logon and access to the online catalogues of over five thousand libraries around the world – an exhilarating taste of what the internet, and web browsers, would soon be able to offer.
In 1989 the original World Wide Web was born. Using a NeXTcube computer, Tim Berners-Lee created a web browser that would change how people used the internet forever. He called his browser the WorldWideWeb(http://www., which is still likely to sound familiar to internet users today. It was a windowed browser capable of displaying simple style sheet, capable of editing sites and able to download and open any file type supported by the NeXTcube.
In 1993 the first popular graphical browser was released. Its name was Mosaic and it was created by Marc Andreessen and Eric Bina. Mosaic could be run on both Unix, and very importantly, on the highly popular Microsoft Windows operating system (incidentally it could also be used on Amiga and Apple computers). It was the first browser on Windows that could display graphics/pictures on a page where there was also textual content. It is often cited as being responsible for triggering the internet boom due to it making the internet bearable for the masses. (It should be noted that the web browser Cello was the first browser to be used on Windows – but it was non graphical and made very little impact compared to Mosaic).
The Browser Wars - Netscape Navigator versus Internet Explorer
Mosaic's decline began almost as soon as Netscape Navigator was released (1994). Netscape Navigator was a browser created by Marc Andreessen, one of the men behind Mosaic and co-founder of Netscape Communications Corporation. Netscape was unrivalled in terms of features and usability at the time. For example, one major change from previous browsers was that it allowed surfers to see parts of a website before the whole site was downloaded. This meant that people did not have to wait for minutes simply to see if the site they were loading was the actual one the were after, whilst also allowing them to read information on the site as the rest of it downloaded. By 1996 Netscape had almost 90% market dominance, as shown below.
Market Share Comparisons of Netscape Navigator and Internet Explorer from 1996 to 1998
....................Netscape.......IE
October 1998..........64%.........32.2%
April 1998............70%.........22.7%
October 1997..........59.67%......15.13%
April 1997............81.13%......12.13%
October 1996..........80.45%......12.18%
April 1996............89.36%.......3.76%
In these two years Netscape clearly dominated the internet browser market, but a new browser named Internet Explorer was quickly gaining ground on it.
Microsoft released their own browser (ironically based on the earlier Mosaic browser which was created by one of the men now running Netscape), clearly worried about Netscape's dominance. It was not so much the worry that it would have a 100% market share of internet browsers on their Windows operating system, but more the worry that browsers would soon be capable of running all types programs on them. That would mean foregoing the need for an actual operating system, or at the most only a very basic one would be needed. This in turn would mean Netscape would soon be able to dictate terms to Microsoft, and Microsoft were not going to let that happen easily. Thus in August 1995, Internet Explorer was released.
By 1999 Internet explorer had captured an 89.03% market share, whilst Netscape was down to 10.47%. How could Internet Explorer make this much ground in just two years? Well this was down to two things really. The first, and by far the most important was that Microsoft bundled Internet Explorer in with every new copy of Windows, and as Windows was used by about 90% of the computer using population it clearly gave them a huge advantage. Internet Explorer had one other ace it held over Netscape – it was much better. Netscape Navigator was stagnant and had been for some time. The only new features it ever seemed to introduce were often perceived by the public as beneficial for Netscape's parent company rather than Netscape's user base. (i.e., features that would help it monopolise the market). Explorer, on the other hand, was given much attention by Microsoft. Regular updates and excellent usability plus a hundred million dollar investment would prove too much for Netscape Explorer.
2000 – 2005
These years were fairly quiet in the Battle of the Browsers. It seemed as if Internet Explorer had won the war and that nobody could even hope to compete with it. In 2002/2003 it had attained about 95% of the market share – about the time of IE 5/6. With over 1000 people working on it and millions of dollars being poured in, few people had the resources to compete. Then again, who wanted to compete? It was clearly a volatile market, and besides that everybody was content with Internet Explorer. Or were they? Some people saw faults with IE – security issues, incompatibility issues or simply bad programming. Not only that, it was being shoved down peoples throats. There was almost no competition to keep it in line or to turn to as an alternative. Something had to change. The only people with the ability and the power to compete with Microsoft took matters into their own hands.
Netscape was now supported by AOL. A few years prior, just after they had lost the Browser Wars to Microsoft, they had released the coding for Netscape into the public domain. This meant anybody could develop their own browser using the Netscape skeleton. And people did. Epiphany, Galeon and Camino, amongst others, were born out of Netscape's ashes. However the two most popular newcomers were called Mozilla and Firefox.
Mozilla was originally an open sourced project aimed to improve the Netscape browser. Eventually it was released as Netscape Navigator 7 and then 8. Later it was released as Mozilla 1.0.
Mozilla was almost an early version on another open source browser, Firefox. With it being an open source the public were able to contribute to it - adding in what features it needed, the programming it required and the support it deserved. The problems people saw in Internet Explorer were being fixed by members of the open sourced browser community via Firefox. For instance, the many security issues IE 6 had were almost entirely fixed in the very first release of Firefox. Microsoft had another fight on their hands.
2005 – Present
Firefox was the browser that grew and grew in these years. Every year capturing an even larger market share percentage than before. More user friendly than most of its rivals along with high security levels and arguably more intelligent programming helped its popularity. With such a large programming community behind it, updates have always been regular and add on programs/features are often released. It prides itself on being the peoples browser. It currently has a 28.38% market share.
Apple computers have had their own browser since the mid 1990's – Safari - complete with its own problems, such as (until recently) the inability to run Java scripts. However most Apple users seemed happy with it and a version capable of running on Windows has been released. It has had no major competitor on Apple Macs, and as such has largely been out of the Browser Wars. It currently holds a 2.54% market share and is slowly increasing.
Internet Explorer's market share has dropped from over 90% to around 75%, and is falling. It will be interesting to see what Microsoft will attempt to regain such a high market share.
Opera currently holds 1.07%.
Mozilla itself only has a 0.6% market share these days.
The Future of Web Browsing
Web browsers come and go. It is the nature of technology (if such a term can be used), to supplant inferior software in very short periods of time. It is almost impossible for a single company to stay ahead of the competition for long. Microsoft have the advantage of being able to release IE with any Windows using PC. That covers over 90% of the market. They also have the advantage of unprecedented resources. They can compete how they wish for as long as they wish. So there is no counting IE out of the future of web browsing.
Safari is in a similar position, being easily the most popular Mac web browser. Its long term survival is dependant upon Apple and the sale of their computers.
These are the only two browsers that are almost guaranteed another five years of life, at least. Firefox may seem like another candidate, but the public is fickle, and one bad release, or if it seriously lags behind the new Internet Explorer 8 for long, could easily see its popularity quickly descend into virtual oblivion.
However, it seems likely community driven browsers, such as Mozilla and Firefox, will be the only types of browser capable of competing with the wealthy internet arm of Microsoft in the near future.
As for web browsing itself, will it change any time soon? Well it already has for some online communities. For example, if you want to buy clothes you could try entering an online 'world' creating an online virtual You to go from 'shop to shop' with, looking at products and trying/buying what you see. Some 'worlds' allow you to recreate yourself accurately including weight and height and then try on things apparel such as jeans to give you an idea of how you would look in that particular item.
Will 'worlds' like this destroy normal web browsers such as IE ? - It seems unlikely. Traditional web browsers provide such freedom and ease of access that it is hard to see any other alternative taking over. However they are part of the new, 'thinking out of the box' wave of alternatives that some people will find attractive, and really who knows what the future will bring.
About The Author
Nicholas C Smith is the project manager at Breakfrom Limited, who specialise in affordable ecommerce solutions and general web design knowledge and advice.
For more information and advice visit http://www.breakfrom.com
Labels :
IT
Friday, January 9, 2009
Computer Cables and Adapters 101
By Ilse Hagen
Computer cables and adapters allow you to connect your computer either to a network or to hardware. Several computer cables and adapters have emerged, but which one is right for your computer system? Read on to find out.
Types of computer cables and adapters
Computer networking cables connect your computer to a mother network. These tools are most commonly used in offices to connect the computer to a single server. Apart from networking cables, there are also USB, printer, and monitor cables. These cables all perform different functions in your computer. The Universal Serial Bus (USB) cable allows for hardware devices to be connected to your computer. USBs are best for plug-and-play devices. Printer cables connect the printer to your cable. Without it, you cannot print documents and images. Finally, a monitor cable connects the monitor to your computer.
Computer adapters
Computer adapters connect your computer to a computer network. There are several types of computer networks available. There is the 1394 net adapter port that connects your computer through a cable. This type of adapter provides FireWire ports for digital devices. Another type of adapter is the 1394 net adapter plug. A 1394 adapter connects to the computer directly.
Making the right choice
In choosing the right computer cables and adapters, it is important to check for compatibility. Do not just buy any cable or adapter – be sure that it is well-suited to your computer’s, your laptop’s, or your hardware’s specifications. Also, for faster connections, choose only a 1394 net adapter that has a 800 Mbps transfer rate for better file transfers.
IMPORTANT SAFETY / SHOPPING INFORMATION
A complete Guide to COMPUTER CABLES AND ADAPTERS is available in Picky Guide, one of the fastest growing online magazines giving free consumer advice and product information.
Article Source: http://EzineArticles.com/?expert=Ilse_Hagen
Computer cables and adapters allow you to connect your computer either to a network or to hardware. Several computer cables and adapters have emerged, but which one is right for your computer system? Read on to find out.
Types of computer cables and adapters
Computer networking cables connect your computer to a mother network. These tools are most commonly used in offices to connect the computer to a single server. Apart from networking cables, there are also USB, printer, and monitor cables. These cables all perform different functions in your computer. The Universal Serial Bus (USB) cable allows for hardware devices to be connected to your computer. USBs are best for plug-and-play devices. Printer cables connect the printer to your cable. Without it, you cannot print documents and images. Finally, a monitor cable connects the monitor to your computer.
Computer adapters
Computer adapters connect your computer to a computer network. There are several types of computer networks available. There is the 1394 net adapter port that connects your computer through a cable. This type of adapter provides FireWire ports for digital devices. Another type of adapter is the 1394 net adapter plug. A 1394 adapter connects to the computer directly.
Making the right choice
In choosing the right computer cables and adapters, it is important to check for compatibility. Do not just buy any cable or adapter – be sure that it is well-suited to your computer’s, your laptop’s, or your hardware’s specifications. Also, for faster connections, choose only a 1394 net adapter that has a 800 Mbps transfer rate for better file transfers.
IMPORTANT SAFETY / SHOPPING INFORMATION
A complete Guide to COMPUTER CABLES AND ADAPTERS is available in Picky Guide, one of the fastest growing online magazines giving free consumer advice and product information.
Article Source: http://EzineArticles.com/?expert=Ilse_Hagen
Labels :
IT
Wednesday, January 7, 2009
How to Clean the Registry
In the beginning Windows' registry consisted of two files totalling around 5mb in size. Today it consists of at least 12 files with the Software file itself being 30mb or bigger in size. As the size of the registry has exploded, so has the trash and clutter in it. It may seem like a daunting task, but cleaning the registry properly can fix system problems, speed your computer up, and make it run more efficiently.
I have spent many years developing and refining thousands of procedures to do just that. I could share these methods of hunting down the trash with you and let you find them and delete them by hand, but if you were to sit down at your computer right now and work nonstop, you would still be busy with them a week from now when the next issue of Ray's Computer Tips arrives. By then your registry would have new clutter and you would have to start all over again.
To make registry cleaning easier on everyone, I wrote a program called RegVac Registry Cleaner (http://regvac.com/regvac.htm) to perform those procedures. It has been so successful that several companies have asked me to model their registry cleaners after RegVac and even more have copied processes that first debutted in RegVac.
The first place RegVac cleans is the HKEY_CLASSES_ROOT section (the Classes Vac in RegVac does this). This section contains settings for the classes of Windows. Think of a huge box full of snakes and you will get an idea of how complicated and interwoven it is. It is so complicated that many registry cleaners bypass it or simply perform surface scans of it. RegVac uses over a hundred processes to follow each tentacle of each class deep into this area and make sure that they abide by the rules.
Next RegVac validates the entries in 22 lists with 7 different methods (the FilesList Vac does this). This is a minor part of RegVac but the bulk of most other registry cleaners even though they usually do not clean all 22 lists.
Another part of RegVac, the Software Vac, which is unique to RegVac, finds old software sections in the registry and provides a way to remove that software's entire branch. Other registry cleaners only remove a few entries in this area often leaving huge portions of the registry that do nothing but take up space and get in the way.
Even more trash can be discovered in hundreds of stashes used to store data you will never use. Most registry cleaners do not even touch these. The Stash Vac lists these stashes and lets you go through and select which ones to empty out. Please use caution when using the Stash Vac because some of the items listed there may be important. For example, one folder in the Stash Vac lists places where data for international keyboards are stored. You probably will never use the data for Bulgarian keyboards, so you can remove it, but if you live in the US you may experience problems after removing the United States 101 keyboard. The items that you can safely remove are usually obvious.
Last but not least, when cleaning the registry, you should look for broken links to files on the computer (this is what the Bad Link Vac does). If a file is referenced in the registry but it does not exist on your hard drive, that is a good indicator that something is wrong. Many programmers start out writing a registry cleaner thinking all it has to do is check for these broken links and remove them. In fact, that is all many registry cleaners do.
Even though that is all they do, they often don't do it correctly. If you check the results of such scans, you will find out that many of the broken links are really good links. I spent several months refining this part of RegVac so that as far as I know it is 100% accurate. Despite this, please realize that some software enter broken links in the registry and require them to be there in order for them to run. RegVac skips the ones it knows about, but you still need to be careful with this part of RegVac.
RegVac has six more tools that clean even more areas: the Add/Remove Editor, the System Config Utility, the OpenWith Editor, the AutoComplete Editor, the Junk Keys Editor, and Registry Backup, Pack, and Restore.
Many of you already use RegVac but if you don't, you can downloaded a free 30 day trial of RegVac at http://regvac.com/regvacz.exe. For more information about RegVac Registry Cleaner go to http://regvac.com/regvac.htm. If you like RegVac, you can purchase it for only $29.95. All future updates are free.
Keep the Windows registry clean and running smoothly with RegVac Registry Cleaner.
by: Ray Geide
I have spent many years developing and refining thousands of procedures to do just that. I could share these methods of hunting down the trash with you and let you find them and delete them by hand, but if you were to sit down at your computer right now and work nonstop, you would still be busy with them a week from now when the next issue of Ray's Computer Tips arrives. By then your registry would have new clutter and you would have to start all over again.
To make registry cleaning easier on everyone, I wrote a program called RegVac Registry Cleaner (http://regvac.com/regvac.htm) to perform those procedures. It has been so successful that several companies have asked me to model their registry cleaners after RegVac and even more have copied processes that first debutted in RegVac.
The first place RegVac cleans is the HKEY_CLASSES_ROOT section (the Classes Vac in RegVac does this). This section contains settings for the classes of Windows. Think of a huge box full of snakes and you will get an idea of how complicated and interwoven it is. It is so complicated that many registry cleaners bypass it or simply perform surface scans of it. RegVac uses over a hundred processes to follow each tentacle of each class deep into this area and make sure that they abide by the rules.
Next RegVac validates the entries in 22 lists with 7 different methods (the FilesList Vac does this). This is a minor part of RegVac but the bulk of most other registry cleaners even though they usually do not clean all 22 lists.
Another part of RegVac, the Software Vac, which is unique to RegVac, finds old software sections in the registry and provides a way to remove that software's entire branch. Other registry cleaners only remove a few entries in this area often leaving huge portions of the registry that do nothing but take up space and get in the way.
Even more trash can be discovered in hundreds of stashes used to store data you will never use. Most registry cleaners do not even touch these. The Stash Vac lists these stashes and lets you go through and select which ones to empty out. Please use caution when using the Stash Vac because some of the items listed there may be important. For example, one folder in the Stash Vac lists places where data for international keyboards are stored. You probably will never use the data for Bulgarian keyboards, so you can remove it, but if you live in the US you may experience problems after removing the United States 101 keyboard. The items that you can safely remove are usually obvious.
Last but not least, when cleaning the registry, you should look for broken links to files on the computer (this is what the Bad Link Vac does). If a file is referenced in the registry but it does not exist on your hard drive, that is a good indicator that something is wrong. Many programmers start out writing a registry cleaner thinking all it has to do is check for these broken links and remove them. In fact, that is all many registry cleaners do.
Even though that is all they do, they often don't do it correctly. If you check the results of such scans, you will find out that many of the broken links are really good links. I spent several months refining this part of RegVac so that as far as I know it is 100% accurate. Despite this, please realize that some software enter broken links in the registry and require them to be there in order for them to run. RegVac skips the ones it knows about, but you still need to be careful with this part of RegVac.
RegVac has six more tools that clean even more areas: the Add/Remove Editor, the System Config Utility, the OpenWith Editor, the AutoComplete Editor, the Junk Keys Editor, and Registry Backup, Pack, and Restore.
Many of you already use RegVac but if you don't, you can downloaded a free 30 day trial of RegVac at http://regvac.com/regvacz.exe. For more information about RegVac Registry Cleaner go to http://regvac.com/regvac.htm. If you like RegVac, you can purchase it for only $29.95. All future updates are free.
Keep the Windows registry clean and running smoothly with RegVac Registry Cleaner.
by: Ray Geide
Labels :
IT
Thursday, January 1, 2009
Back to Back User Agents for Telecommunications
by: Danny Loeb
Today’s telecommunications networks are a delicate blend of clients and servers that together offer virtually endless possibilities when it comes to services and applications. For every new client developed, there seems to be a score more on the way — from mobile handsets, PDAs, terminals, telephones, video phones, IP set-top-boxes, and so on.
There are essentially two types of servers that connect between clients on large networks: Proxy servers and Back-to-Back User Agent (B2BUA) servers. The more prevalent Proxy servers feature predictable behavior — simply connecting between clients. Effectively, B2BUA servers are much stronger and intelligent entities that perform actions which Proxy servers cannot. Moreover, B2BUA servers provide a flexible solution for a wide range of applications and services and are becoming the primary engine for more and more SIP servers in NGN and IMS networks.
The difference between Proxy servers and B2BUA servers is sometimes not fully understood. In this article, we will explore what makes B2BUA servers such an appealing alternative to standard Proxy servers. Better understanding of B2BUA servers can help managers understand the value, and the tradeoffs, of choosing a B2BUA server, as well as the frameworks needed to develop a wide range of SIP applications and SIP services using it.
Figure 1 - Architectural difference between Proxy servers and B2BUA servers
B2BUA Server Defined
B2BUA servers are used to provide value added features for point-to-point calls and manage multi-point calls. The power behind a B2BUA server is derived mostly from the fact that it has a very generic definition, which gives it almost unlimited power. However, this same characteristic is the root of the controversy surrounding it.
IETF standard (RFC 3261) defines a back-to-back user agent as “a logical entity that receives a request and processes it as a user agent server (UAS). In order to determine how the request should be answered, it acts as a user agent client (UAC) and generates requests. Unlike a Proxy server, it maintains a dialogue state and must participate in all requests sent on the dialogues it has established.”
B2BUA servers have capabilities that far exceed those of other types of SIP servers, and answer the need for developing sophisticated value added SIP applications that cannot be implemented as Proxy applications.
Some of these capabilities, which are unique to B2BUA servers, are outlined below:
3rd Party Call Control (3PCC) Features
3rd Party Call Control (3PCC) is the ability of an entity (usually a controller) to set up and manage communication between two or more parties. 3PCC is often used for operator services and conferencing.
3PCC actions are important capabilities, exclusive to B2BUA servers since “passive” non call-stateful elements, such as Proxy servers, cannot initiate these types of activities. Some examples of 3PCC services are online billing, QoS, resource prioritization, call transfer, click-to-dial, mid-call announcement and more.
3PCC actions can be initiated automatically by B2BUA server applications, like disconnecting a call following credit expiration in an online-billing system. Or they can be initiated by remote administrative control (OSS), e.g. invite parties to a multi-point conferencing session.
Figure 2 - Schematic outline of B2BUA server offering 3PCC functionality
Inter-working Function (IWF) for Interoperability
SIP was designed as a highly flexible and extendible protocol. The very strength of this flexibility is also an inherent weakness, since the vast array of client types in the market still need to connect.
B2BUA Inter-working Functions (IWF) defines a wide range of powerful SIP servers that connect SIP clients that “speak” in different protocol dialects, or support different capabilities. This Inter-working function is very important in enabling connectivity between clients with different capabilities and/or protocol dialects. Or even between clients and networks – where the B2BUA server actually acts as an access device.
Examples of what IWF can do include:
• Connecting SIP clients to IMS networks by adding and removing IMS SIP protocol extensions (AKA P-Headers) that are essential for connecting to the IMS network
• Connecting clients with different Session Timers settings
• Connecting clients with different media capabilities and with distinct Session Description Protocol (SDP) messages by relaying between the two types of control sessions
• Connecting to different types of networks (e.g. IPv4, IPv6) and support for different transport types, such as TCP/UDP/SCTP/TLS
Figure 3 - Schematic outline of a B2BUA Inter-Working Function
Multi-point Call Management
B2BUA servers an also implement multi-point call scenarios where multiple CPE devices connect to the B2BUA, and the B2BUA provides services to all CPE.
Due to these unique capabilities, B2BUA servers are widely used in the communications industry. A few examples are listed below:
• Online-billing/prepaid functions
• Servers supporting Resource Prioritization (RP) and/or Quality of Service (QoS) features
• Multi Point Conferencing servers
• IVR servers
• PBX Applications and Softswitches
• Application Layer Gateways (ALG)
• FW/NAT Traversal applications
• Privacy servers
• 3rd-Party Call Control Applications (3PCC)
• Service Creation Environment (SCE) runtime engines
• Session Boarder Controller (SBC)
• IMS S-CSCF, P-CSCF, I-CSCF
• SIP Inter-work Function (IWF) Gateway
• Security Gateway (SEG)
• Voice Call Continuity (VCC) servers
In addition, B2BUA servers play an important role in emerging IMS networks. Recent releases of 3GPP IMS specifications (3GPP TS 24.229 V8.0.0) indicate that an increasing number of IMS network element servers, such as P-CSCF, IBCF,SBC etc., are B2BUA servers. The reason for this is that value added services are usually session stateful, and feature capabilities that go beyond basic call proxying. Applications written on top of B2BUA Application servers fulfill several roles, such as SIP User Agents, SIP Proxy servers and SIP Registrars.
B2BUA Server Challenges
B2BUA application developers face many challenges, such as achieving rapid time-to-market, conformance and interoperability, offering customization for proprietary services and support for High Availability (HA) and redundancy. A comprehensive B2BUA framework can help developers overcome these challenges.
A solid B2BUA framework should have modular application building block architecture for increased flexibility, abstraction and short delivery time. Traditional architecture, which features a single configurable state machine, is not flexible enough. Also, a B2BUA framework should facilitate developing B2BUA applications by flexibly linking “pluggable” high-level Modular Application Building Blocks (MABB). Developers should have the ability to combine these MABBs and they should be designed in a way that allows developers to further customize their behavior if needed. This type of architecture complies with contemporary Service Oriented Architecture (SOA) concepts, and is suitable for powering flexible business communication platforms. This modular architecture can save months of work. With a set of MABBs in hand, developing the application is a matter of combining existing MABBs to produce the required business logic. In addition, this architecture enhances efficiency; development of new MABBs can be done concurrently.
A B2BUA framework should facilitate developing applications that fully conform to standards and are interoperable; without restricting developers from customizing protocol behavior for special cases. Moreover, it should conform for non-standard implementations, as well as to mediate between two versions of the same standard. This type of framework allows developers to focus on their proprietary application with the confidence that their final application will be fully interoperable.
And finally, a B2BUA framework should provide the ability to configure, amend and replace application building blocks to create proprietary features. With this ability, developers can maximize existing code – significantly reducing development time, shortening testing cycles, and reducing overall time-to-market.
Figure 4 - Traditional architecture of a B2BUA framework
RADVISION’s B2BUA Application Framework http://www.radvision.com/Products/Developer/SIPServer delivers these capabilities and more. The B2BUA Application Framework module is a part of the RADVISION SIP server Platform, a software framework that offers the essential building blocks for the development of a wide variety of high performance SIP and IMS servers. The rich set of components and modules can be flexibly combined to match customers’ requirements for developing SIP servers that offer both standard and advanced SIP services.
Applications written on top of RADVISION’s B2BUA framework are developed by combining customizable modular application building blocks. This is effectively large chunks of functionality that can be strung together to form ad-hoc applications, enabling developers to focus on the high-level business logic and use building blocks that hide low-level details.
As one of the most popular IM applications, Yahoo! Messenger was the first large consumer player that adopted B2B UA. Yahoo! Messenger combined its backend scalable platform with RADVISION’s B2B UA to serve millions of monthly unique messaging users around the world. Yahoo selected RADVISION’s B2BUA due to its robust performance and scalability features.
Figure 5 - The architecture of RADVISION B2BUA Application Framework
RADVISION also offers automatic High Availability (HA) and Redundancy support. The B2BUA framework automatically replicates the run-time state of the different Services and B2BUA framework core. In the event of a server outage, a redundant server takes over seamlessly and provides uninterrupted service continuity.
B2BUA framework benefits in a nutshell
• Significantly reduces time to market developing proprietary B2B applications and services.
• Allows adding advanced services easily to retain competitive advantage and evolve to meet growing customer demands.
• Focuses on the business logic and hides low level operator communication intricacies.
• Delivers off-the-shelf conformance and interoperability.
• Enables rapid development of applications that can interoperate with different vendors.
• Enables adding high-availability features easily.
Today’s telecommunications networks are a delicate blend of clients and servers that together offer virtually endless possibilities when it comes to services and applications. For every new client developed, there seems to be a score more on the way — from mobile handsets, PDAs, terminals, telephones, video phones, IP set-top-boxes, and so on.
There are essentially two types of servers that connect between clients on large networks: Proxy servers and Back-to-Back User Agent (B2BUA) servers. The more prevalent Proxy servers feature predictable behavior — simply connecting between clients. Effectively, B2BUA servers are much stronger and intelligent entities that perform actions which Proxy servers cannot. Moreover, B2BUA servers provide a flexible solution for a wide range of applications and services and are becoming the primary engine for more and more SIP servers in NGN and IMS networks.
The difference between Proxy servers and B2BUA servers is sometimes not fully understood. In this article, we will explore what makes B2BUA servers such an appealing alternative to standard Proxy servers. Better understanding of B2BUA servers can help managers understand the value, and the tradeoffs, of choosing a B2BUA server, as well as the frameworks needed to develop a wide range of SIP applications and SIP services using it.
Figure 1 - Architectural difference between Proxy servers and B2BUA servers
B2BUA Server Defined
B2BUA servers are used to provide value added features for point-to-point calls and manage multi-point calls. The power behind a B2BUA server is derived mostly from the fact that it has a very generic definition, which gives it almost unlimited power. However, this same characteristic is the root of the controversy surrounding it.
IETF standard (RFC 3261) defines a back-to-back user agent as “a logical entity that receives a request and processes it as a user agent server (UAS). In order to determine how the request should be answered, it acts as a user agent client (UAC) and generates requests. Unlike a Proxy server, it maintains a dialogue state and must participate in all requests sent on the dialogues it has established.”
B2BUA servers have capabilities that far exceed those of other types of SIP servers, and answer the need for developing sophisticated value added SIP applications that cannot be implemented as Proxy applications.
Some of these capabilities, which are unique to B2BUA servers, are outlined below:
3rd Party Call Control (3PCC) Features
3rd Party Call Control (3PCC) is the ability of an entity (usually a controller) to set up and manage communication between two or more parties. 3PCC is often used for operator services and conferencing.
3PCC actions are important capabilities, exclusive to B2BUA servers since “passive” non call-stateful elements, such as Proxy servers, cannot initiate these types of activities. Some examples of 3PCC services are online billing, QoS, resource prioritization, call transfer, click-to-dial, mid-call announcement and more.
3PCC actions can be initiated automatically by B2BUA server applications, like disconnecting a call following credit expiration in an online-billing system. Or they can be initiated by remote administrative control (OSS), e.g. invite parties to a multi-point conferencing session.
Figure 2 - Schematic outline of B2BUA server offering 3PCC functionality
Inter-working Function (IWF) for Interoperability
SIP was designed as a highly flexible and extendible protocol. The very strength of this flexibility is also an inherent weakness, since the vast array of client types in the market still need to connect.
B2BUA Inter-working Functions (IWF) defines a wide range of powerful SIP servers that connect SIP clients that “speak” in different protocol dialects, or support different capabilities. This Inter-working function is very important in enabling connectivity between clients with different capabilities and/or protocol dialects. Or even between clients and networks – where the B2BUA server actually acts as an access device.
Examples of what IWF can do include:
• Connecting SIP clients to IMS networks by adding and removing IMS SIP protocol extensions (AKA P-Headers) that are essential for connecting to the IMS network
• Connecting clients with different Session Timers settings
• Connecting clients with different media capabilities and with distinct Session Description Protocol (SDP) messages by relaying between the two types of control sessions
• Connecting to different types of networks (e.g. IPv4, IPv6) and support for different transport types, such as TCP/UDP/SCTP/TLS
Figure 3 - Schematic outline of a B2BUA Inter-Working Function
Multi-point Call Management
B2BUA servers an also implement multi-point call scenarios where multiple CPE devices connect to the B2BUA, and the B2BUA provides services to all CPE.
Due to these unique capabilities, B2BUA servers are widely used in the communications industry. A few examples are listed below:
• Online-billing/prepaid functions
• Servers supporting Resource Prioritization (RP) and/or Quality of Service (QoS) features
• Multi Point Conferencing servers
• IVR servers
• PBX Applications and Softswitches
• Application Layer Gateways (ALG)
• FW/NAT Traversal applications
• Privacy servers
• 3rd-Party Call Control Applications (3PCC)
• Service Creation Environment (SCE) runtime engines
• Session Boarder Controller (SBC)
• IMS S-CSCF, P-CSCF, I-CSCF
• SIP Inter-work Function (IWF) Gateway
• Security Gateway (SEG)
• Voice Call Continuity (VCC) servers
In addition, B2BUA servers play an important role in emerging IMS networks. Recent releases of 3GPP IMS specifications (3GPP TS 24.229 V8.0.0) indicate that an increasing number of IMS network element servers, such as P-CSCF, IBCF,SBC etc., are B2BUA servers. The reason for this is that value added services are usually session stateful, and feature capabilities that go beyond basic call proxying. Applications written on top of B2BUA Application servers fulfill several roles, such as SIP User Agents, SIP Proxy servers and SIP Registrars.
B2BUA Server Challenges
B2BUA application developers face many challenges, such as achieving rapid time-to-market, conformance and interoperability, offering customization for proprietary services and support for High Availability (HA) and redundancy. A comprehensive B2BUA framework can help developers overcome these challenges.
A solid B2BUA framework should have modular application building block architecture for increased flexibility, abstraction and short delivery time. Traditional architecture, which features a single configurable state machine, is not flexible enough. Also, a B2BUA framework should facilitate developing B2BUA applications by flexibly linking “pluggable” high-level Modular Application Building Blocks (MABB). Developers should have the ability to combine these MABBs and they should be designed in a way that allows developers to further customize their behavior if needed. This type of architecture complies with contemporary Service Oriented Architecture (SOA) concepts, and is suitable for powering flexible business communication platforms. This modular architecture can save months of work. With a set of MABBs in hand, developing the application is a matter of combining existing MABBs to produce the required business logic. In addition, this architecture enhances efficiency; development of new MABBs can be done concurrently.
A B2BUA framework should facilitate developing applications that fully conform to standards and are interoperable; without restricting developers from customizing protocol behavior for special cases. Moreover, it should conform for non-standard implementations, as well as to mediate between two versions of the same standard. This type of framework allows developers to focus on their proprietary application with the confidence that their final application will be fully interoperable.
And finally, a B2BUA framework should provide the ability to configure, amend and replace application building blocks to create proprietary features. With this ability, developers can maximize existing code – significantly reducing development time, shortening testing cycles, and reducing overall time-to-market.
Figure 4 - Traditional architecture of a B2BUA framework
RADVISION’s B2BUA Application Framework http://www.radvision.com/Products/Developer/SIPServer delivers these capabilities and more. The B2BUA Application Framework module is a part of the RADVISION SIP server Platform, a software framework that offers the essential building blocks for the development of a wide variety of high performance SIP and IMS servers. The rich set of components and modules can be flexibly combined to match customers’ requirements for developing SIP servers that offer both standard and advanced SIP services.
Applications written on top of RADVISION’s B2BUA framework are developed by combining customizable modular application building blocks. This is effectively large chunks of functionality that can be strung together to form ad-hoc applications, enabling developers to focus on the high-level business logic and use building blocks that hide low-level details.
As one of the most popular IM applications, Yahoo! Messenger was the first large consumer player that adopted B2B UA. Yahoo! Messenger combined its backend scalable platform with RADVISION’s B2B UA to serve millions of monthly unique messaging users around the world. Yahoo selected RADVISION’s B2BUA due to its robust performance and scalability features.
Figure 5 - The architecture of RADVISION B2BUA Application Framework
RADVISION also offers automatic High Availability (HA) and Redundancy support. The B2BUA framework automatically replicates the run-time state of the different Services and B2BUA framework core. In the event of a server outage, a redundant server takes over seamlessly and provides uninterrupted service continuity.
B2BUA framework benefits in a nutshell
• Significantly reduces time to market developing proprietary B2B applications and services.
• Allows adding advanced services easily to retain competitive advantage and evolve to meet growing customer demands.
• Focuses on the business logic and hides low level operator communication intricacies.
• Delivers off-the-shelf conformance and interoperability.
• Enables rapid development of applications that can interoperate with different vendors.
• Enables adding high-availability features easily.
Labels :
IT
Subscribe to:
Posts (Atom)
