My photo
jakarta pusat, jakarta, Indonesia
Showing posts with label info. Show all posts
Showing posts with label info. Show all posts

Tuesday, May 12, 2009

Health Info : Flu Singapore / RNA Virus

SINGAPORE FLU or HAND MOUTH Foot Disease (HFMD)


DEFINITION

"singapore flu" is actually the disease in the world of medicine known as hand, foot and mouth disease (hfmd) or in the language of Indonesia disease, foot and mouth (ptkm). Indeed, this disease has been there in the world. Based on the reports that exist, extraordinary events of this already in 1957 in Toronto, Canada. Since there are many events around the world. In Indonesia, the disease itself is actually not a new disease. The term "flu singapore" appears because the explosion occurred when the cases and deaths due to this disease in Singapore. because of flu-like symptoms, and when that happens in Singapore (and also happens in Indonesia), many print media that makes the term "flu singapore", although this is not a standard terminology.


Causes

PTKM this disease is an infection caused by RNA viruses in the family who enter picornaviridae (pico, Spain = small), enterovirus genus (non-polio). Genus is a rhinovirus, cardiovirus, apthovirus. In the enterovirus genus consists of a coxsackie virus, coxsackie b virus, echovirus and enterovirus. The cause of the most frequently ptkm on outpatient is coxsackie A16, and that often require treatment because the situation is more serious complications or death is up to enterovirus 71. Enterovirus can cause various diseases.


epidemiology:

this disease is highly infectious and often occur in summer. PTKM is a disease that often occur in dense groups of people who attack and children age 2 months to 5 years (sometimes up to 10 years). Adults are generally more immune against enterovirus, even if it can be also affected. Penularannya through the fekal-pral (digestion) and the respiratory channel, namely from the droplet (particle saliva), runny nose, saliva, feces, fluid vesikel (deviation form of skin containing small bubble fluid) or ekskreta. Spread through direct contact is not goods, towels, clothes, food equipment, and toys that terkontaminasi by sekresi it. vectors but does not have any carrier ( "carrier") such as fly and kecoa. It gives specific immunity, but children can be affected more by ptkm virus strain other enterovirus. Incubation period of 2 - 5 days.


SYMPTOMS

At first not a high fever 2-3 days, followed by neck pain (faringitis), no appetite, runny nose, symptoms such as "flu" in general that is not death. Vesikel that arise and then broke out, there are 3-10 ulkus in the mouth, such as sariawan (tongue, gum, in the cheek) feels pain so difficult to swallow. Along with the rash relief / rash or vesikel (reddish blister / Blister small and flat), papulovesikel not ditelapak itchy hands and feet. Sometimes the rash / rash (makulopapel) have dibokong. Generally, this disease will be improved in the 7-10 days, and does not need to be treated in the hospital.

When symptoms have a significant weight, the patient should be treated in the hospital. Symptoms are quite heavy, among others:
- Hiperpireksia, namely high fever with temperatures more than 39 c.
- Fever does not go down-down
- Takikardia (a fast pulse)
- Takipneu of breath so quickly and packed
- Lazy eating, vomiting, or diarrhea with dehydration repeated.
- Letargi, weak, sleepy and hold
- Pain in the neck, arms, and legs.
- Strain-strain, or the nerve paralysis occurred kranial
- Cold sweat
- Fotofobia (not see-ray-resistant)
- Tension in the abdomen
- Halusinasi or interference awareness

Disease complications are:
- Meningitis (meningitis brain) that aseptik - encephalitis (brain inflammation)
- Myocarditis (coxsackie virus carditis) or pericarditis - acute flaccid paralysis / polio paralyzed acute ( "polio-like illness")


One group with this disease are:

1. vesicular stomatitis with exanthem (ptkm) - Cox a 16, EV 71 (disease)

2. vesicular pharyngitis (herpangina) - EV 70

3. acute lymphonodular pharyngitis - a 10 Cox



Diagnosis


Laboratory:
samples (specimens) can be taken from the feces, rektal Wipe, Wipe and serebrospinal fluid / swab ulcus in the mouth / throat, vesikel in skin biopsy specimens, or the brain.
Specimens taken with "hank's virus transport." isolation of virus with the cell culture with the suckling mouse inoculation. After the "tissue culture", and can be identified with the antisera specific strainnya / IPA, ct, etc. PCR. examination can be done to see an increase in antibody titer.



Diagnostic laboratories are as follows:

1. virus detection:
- Immuno histochemistry (in situ)
- Imunofluoresensi antibody (indirek)
- Isolation and identification of the virus.
in vero cells; rd; l20b
netralisasi test against intersekting pools
antisera (Schmidt pools) or EV-71 (Nagoya) antiserum.

2. RNA detection:
rt-PCR
primer: 5 'ctactttgggtgtccgtgtt 3 "
5 'gggaacttcgattaccatcc 3 "
partial dna sekuensing (PCR product)

3. serodiagnosis:
serokonversi paired sera with the test serum netralisasi against EV-71 virus (brcr, Nagoya) on vero cells. Elisa test is being developed. The actual clinical enough to diagnose ptkm, we can only mengatahui whether a cause-coxsackie enterovirus 16 or 71.



Medicine

1 .. adequate rest

2. there is no specific treatment, so only the simptomatik only given based on the clinical situation.

3. can be given:
- Iv immunoglobulin (igiv), in patients imunokompromis or neonatus
- Extracorporeal Membrane oxygenation.

4. treatment simptomatik:
- Antiseptic in the mouth
- Analgesic eg paracetamol
- Fluid enough to dehydration caused by drinking and difficult because of fever
- Suportif other treatment (diet, etc.)


This disease is "self limiting diseases", namely can be cured by itself, in 7-10 days, patients need to rest because the body's resistance to decrease. Patients who are treated with the weight and symptoms of complications, respectively.





PREVENTION

disease prevention and control:

This disease often occurs in people with a lack of good sanitation. Prevention of disease is to eliminate kekumuhan and density environment; hygiene (hygiene and sanitation) environment and individuals.
Way that is most easily done for example wont always wash hands, particularly after quarters with people, food decontamination equipment, toys, towels that allows terkontaminasi.

If the child does not need to attend school for one week after the rash arising lost to heat. Patients do not actually need to be deported because ekskresi virus still take several weeks after symptoms disappear, it is important to maintain the hygiene of individuals.

In the hospital "universal precaution" should be implemented. This disease can not be prevented with a vaccine (immunization)


The government's efforts in this regard:

Increasing surveillance epidemiology (clinical definition of need) to provide counseling about ways of transmission and prevention ptkm to cut the chain of transmission. Provide counseling about the signs and symptoms ptkm
keep the individual.



When the child is not treated, it should rest at home for:
- Decreased body resistance.
- Not transmit kebalita other.
set up health facilities, including about tatalaksana ptkm
implementation of the "universal precaution" is.



Related news:

http://www.sinarharapan.co.id/berita/0109/07/fea01.html


http://www.litbang.depkes..go.id/aktual/kliping/virus_singapura190306.htm